From 2094f59d2dacabfda25d10bea4176ce616f551b3 Mon Sep 17 00:00:00 2001 From: Ubuntu Date: Sat, 9 May 2026 11:17:33 +0000 Subject: [PATCH 01/17] Add nf-core/eager style ancient DNA (aDNA) analysis workflow --- .../aDNA-analysis/.dockstore.yml | 11 + .../paleogenomics/aDNA-analysis/CHANGELOG.md | 5 + .../paleogenomics/aDNA-analysis/README.md | 72 + .../aDNA-analysis/aDNA-analysis-tests.yml | 77 + .../aDNA-analysis/aDNA-analysis.ga | 1316 +++++++++++++++++ 5 files changed, 1481 insertions(+) create mode 100644 workflows/paleogenomics/aDNA-analysis/.dockstore.yml create mode 100644 workflows/paleogenomics/aDNA-analysis/CHANGELOG.md create mode 100644 workflows/paleogenomics/aDNA-analysis/README.md create mode 100644 workflows/paleogenomics/aDNA-analysis/aDNA-analysis-tests.yml create mode 100644 workflows/paleogenomics/aDNA-analysis/aDNA-analysis.ga diff --git a/workflows/paleogenomics/aDNA-analysis/.dockstore.yml b/workflows/paleogenomics/aDNA-analysis/.dockstore.yml new file mode 100644 index 0000000000..5065b9a4ac --- /dev/null +++ b/workflows/paleogenomics/aDNA-analysis/.dockstore.yml @@ -0,0 +1,11 @@ +version: 1.2 +workflows: +- name: aDNA-analysis + subclass: Galaxy + publish: true + primaryDescriptorPath: /aDNA-analysis.ga + testParameterFiles: + - /aDNA-analysis-tests.yml + authors: + - name: Ali Mert AYDIN + orcid: "https://orcid.org/0009-0008-9038-0815" diff --git a/workflows/paleogenomics/aDNA-analysis/CHANGELOG.md b/workflows/paleogenomics/aDNA-analysis/CHANGELOG.md new file mode 100644 index 0000000000..06913e9995 --- /dev/null +++ b/workflows/paleogenomics/aDNA-analysis/CHANGELOG.md @@ -0,0 +1,5 @@ +# Changelog + +## [0.1] - 2026-05-09 + +- First release. \ No newline at end of file diff --git a/workflows/paleogenomics/aDNA-analysis/README.md b/workflows/paleogenomics/aDNA-analysis/README.md new file mode 100644 index 0000000000..7868f47c63 --- /dev/null +++ b/workflows/paleogenomics/aDNA-analysis/README.md @@ -0,0 +1,72 @@ +# Ancient DNA analysis pipeline +This workflow performs an ancient DNA (aDNA) based analysis similar to the one in the [nf-core/eager](https://nf-co.re/eager/2.5.3/) workflow. nf-core/eager is a bioinformatics best-practise processing pipeline for genomic NGS sequencing data, with a focus on ancient DNA data. It is ideal for the (palaeo)genomic analysis of humans, animals, plants, microbes and even microbiomes. + +The pipeline pre-processes raw data from FASTQ inputs, or preprocessed BAM inputs. It can align reads and performs extensive general NGS and aDNA specific quality-control on the results. + + +## Required Inputs +To run this workflow successfully, you need to provide the following input datasets: + +* **`InputReads` :** The raw sequencing data for your sample in `FASTQ` format. The workflow supports both single-end and paired-end reads. +* **`ReferenceGenome` :** The reference genome sequence for your target organism in `FASTA` format. This is essential for read mapping (BWA) and variant calling. +* **`HapMapChrXReference` :** A reference HapMap dataset file. This is required by the ANGSD tool to estimate nuclear X-chromosome contamination in human ancient DNA samples. + + +## Workflow Steps +By default the pipeline currently performs the following: + +## 1. Preprocessing and Quality Control +* **Format Conversion:** Converts input files from BAM/SAM format to FASTQ format (`Picard SamToFastq`) +* **Quality Control:** Evaluates read quality before and after trimming (`FastQC`) +* **Adapter Trimming:** Removes adapter sequences and merges paired-end reads (`AdapterRemoval`) + +## 2. Read Mapping and Processing +* **Alignment:** Maps reads to the provided reference genome (`BWA`) +* **Filtering and Statistics:** Separates unmapped reads and calculates alignment statistics (`Samtools View and Flagstat`) +* **Duplicate Removal:** Detects and marks PCR duplicates (`Picard MarkDuplicates`) +* **Alignment Quality:** Generates detailed BAM quality metrics (`QualiMap BamQC`) +* **Library Complexity:** Estimates library complexity (`Preseq`) + +## 3. Ancient DNA (aDNA) Analysis +* **Damage Profiling:** Visualizes aDNA-specific C-to-T damage patterns (`mapDamage`) +* **Endogenous Content:** Calculates the proportion of endogenous (target) DNA in the sample (`EndorSpy`) +* **Contamination:** Estimates nuclear X-chromosome contamination using HapMap data (`ANGSD X-Contamination`) + +## 4. Biological Information +* **Sex Determination:** Determines biological sex based on relative chromosome coverage ratio (`Sex.DetERRmine`) +* **Mt/Nuc Ratio:** Calculates the ratio of mitochondrial reads to nuclear reads (`MtNucRatioCalculator`) + +## 5. Genotyping +* **Variant Analysis:** Performs variant calling to generate VCF files (`FreeBayes`) +* **Variant Statistics:** Calculates statistics for the generated variants (`Bcftools stats`) + +## 6. Metagenomic Screening (For Unmapped Reads) +* **Read Extraction:** Extracts unmapped reads for microbial analysis (`Picard SamToFastq`) +* **Quality Filter:** Filters low-complexity sequences (`BBTools BBduk`) +* **Taxonomic Classification:** Performs microbiome/taxonomic screening without alignment (`Kraken2`) + +## 7. Reporting +* **Summary Report:** Aggregates logs and statistics from all these tools into a single interactive HTML report (`MultiQC`) + + +## Workflow Outputs +Upon successful execution, the workflow explicitly highlights and provides the following final files for analysis: + +* **`MultiQC Report` :** An interactive HTML report aggregating QC and analysis logs from all tools. +* **`QualiMap BamQC Report` :** A detailed HTML report containing mapping quality metrics, GC content, and coverage statistics. +* **`mapDamage Visualisation` :** Visual plots displaying the characteristic C-to-T deamination patterns at the ends of ancient DNA reads. +* **`Kraken2 Report `:** A tabular report showing the taxonomic classification of unmapped reads. +* **`EndorSpy Report `:** A JSON file containing the calculated endogenous DNA percentage. +* **`Sex.DetERRmine Report` :** A JSON file containing relative chromosomal coverage and the calculated biological sex metrics. +* **`Mt/Nuc Ratio Report` :** A JSON file containing the calculated ratio between mitochondrial and nuclear reads. +* **`ANGSD Contamination Report` :** A tabular text file detailing the estimates of nuclear X-chromosome contamination. +* **`Bcftools Stats Report` :** A text file containing comprehensive summary statistics for the called variants (VCF). + + +## Testing Data +To ensure the workflow functions correctly, it was validated using the following datasets and databases: + +* **`Primary Test Data` :** The [JK2067](https://github.com/nf-core/test-datasets/blob/eager/testdata/Human/bam/JK2067.bam) BAM file (HiSeq 1240k captured UDG-half single-end libraries containing approximately 10,000 reads post-clipping) obtained from Lamnidis et al., 2018, Nat. Comms. +* **`Primary Reference Genome` :** The [hs37d5_chr21-MT.fa.gz](https://github.com/nf-core/test-datasets/blob/eager/reference/Human/hs37d5_chr21-MT.fa.gz) file was utilized as the primary reference genome sequence. +* **`X-Chromosome Contamination Reference` :** The [HapMap ChrX](https://github.com/ANGSD/angsd/blob/master/RES/HapMapChrX.gz) dataset was provided as the initial reference for the estimation of X-chromosome contamination using the ANGSD tool. +* **`Taxonomic Classification Database` :** The Minikraken v2 database was utilized to perform taxonomic classification via Kraken2. \ No newline at end of file diff --git a/workflows/paleogenomics/aDNA-analysis/aDNA-analysis-tests.yml b/workflows/paleogenomics/aDNA-analysis/aDNA-analysis-tests.yml new file mode 100644 index 0000000000..90faea0cbc --- /dev/null +++ b/workflows/paleogenomics/aDNA-analysis/aDNA-analysis-tests.yml @@ -0,0 +1,77 @@ +- doc: Test outline for aDNA-analysis.ga + job: + InputReads: + class: File + location: https://github.com/nf-core/test-datasets/raw/eager/testdata/Human/bam/JK2067.bam + filetype: bam + ReferenceGenome: + class: File + location: https://github.com/nf-core/test-datasets/raw/eager/reference/Human/hs37d5_chr21-MT.fa.gz + filetype: fasta.gz + HapMapChrXReference: + class: File + location: https://github.com/ANGSD/angsd/raw/master/RES/HapMapChrX.gz + filetype: gz + outputs: + EndorSpyReport: + asserts: + has_text: + text: "percent_on_target" + SexdetERRmineReport: + asserts: + has_text: + text: "Sex.DetERRmine" + MtNucReport: + asserts: + has_text: + text: "mtnuccalculator" + BamQCReport: + asserts: + has_text: + text: "Qualimap Report: BAM QC" + DamageVisualisation: + element_tests: + dnacomp: + asserts: + has_text: + text: "mapDamage" + misincorporation: + asserts: + has_text: + text: "mapDamage" + 5pCtoT_freq: + asserts: + has_text: + text: "5pC>T" + 3pGtoA_freq: + asserts: + has_text: + text: "3pG>A" + Fragmisincorporation_plot: + asserts: + has_size: + min: 100 + lgdistribution: + asserts: + has_text: + text: "mapDamage" + Length_plot: + asserts: + has_size: + min: 100 + ANGSDReport: + asserts: + has_text: + text: "Method1_MOM_estimate" + bcftoolsReport: + asserts: + has_text: + text: "ACT>TCGA" + Kraken2Report: + asserts: + has_text: + text: "root" + MultiQCReport: + asserts: + has_text: + text: "MultiQC" diff --git a/workflows/paleogenomics/aDNA-analysis/aDNA-analysis.ga b/workflows/paleogenomics/aDNA-analysis/aDNA-analysis.ga new file mode 100644 index 0000000000..60f184108c --- /dev/null +++ b/workflows/paleogenomics/aDNA-analysis/aDNA-analysis.ga @@ -0,0 +1,1316 @@ +{ + "a_galaxy_workflow": "true", + "annotation": "This workflow performs an ancient DNA based analysis similar to the one in the nf-core/eager workflow", + "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0009-0008-9038-0815", + "name": "Ali Mert AYDIN" + } + ], + "format-version": "0.1", + "license": "MIT", + "release": "0.1", + "name": "Ancient DNA analysis", + "readme": "# Pipeline Summary\nThis workflow performs an ancient DNA (aDNA) based analysis similar to the one in the [nf-core/eager](https://nf-co.re/eager/2.5.3/) workflow. nf-core/eager is a bioinformatics best-practise processing pipeline for genomic NGS sequencing data, with a focus on ancient DNA data. It is ideal for the (palaeo)genomic analysis of humans, animals, plants, microbes and even microbiomes.\n\nThe pipeline pre-processes raw data from FASTQ inputs, or preprocessed BAM inputs. It can align reads and performs extensive general NGS and aDNA specific quality-control on the results.\n\n\n## Required Inputs\nTo run this workflow successfully, you need to provide the following input datasets:\n\n* **`InputReads` :** The raw sequencing data for your sample in `FASTQ` format. The workflow supports both single-end and paired-end reads.\n* **`ReferenceGenome` :** The reference genome sequence for your target organism in `FASTA` format. This is essential for read mapping (BWA) and variant calling.\n* **`HapMapChrXReference` :** A reference HapMap dataset file. This is required by the ANGSD tool to estimate nuclear X-chromosome contamination in human ancient DNA samples.\n\n\n## Workflow Steps\nBy default the pipeline currently performs the following:\n\n## 1. Preprocessing and Quality Control\n* **Format Conversion:** Converts input files from BAM/SAM format to FASTQ format (`Picard SamToFastq`)\n* **Quality Control:** Evaluates read quality before and after trimming (`FastQC`)\n* **Adapter Trimming:** Removes adapter sequences and merges paired-end reads (`AdapterRemoval`)\n\n## 2. Read Mapping and Processing\n* **Alignment:** Maps reads to the provided reference genome (`BWA`)\n* **Filtering and Statistics:** Separates unmapped reads and calculates alignment statistics (`Samtools View and Flagstat`)\n* **Duplicate Removal:** Detects and marks PCR duplicates (`Picard MarkDuplicates`)\n* **Alignment Quality:** Generates detailed BAM quality metrics (`QualiMap BamQC`)\n* **Library Complexity:** Estimates library complexity (`Preseq`)\n\n## 3. Ancient DNA (aDNA) Analysis\n* **Damage Profiling:** Visualizes aDNA-specific C-to-T damage patterns (`mapDamage`)\n* **Endogenous Content:** Calculates the proportion of endogenous (target) DNA in the sample (`EndorSpy`)\n* **Contamination:** Estimates nuclear X-chromosome contamination using HapMap data (`ANGSD X-Contamination`)\n\n## 4. Biological Information\n* **Sex Determination:** Determines biological sex based on relative chromosome coverage ratio (`Sex.DetERRmine`)\n* **Mt/Nuc Ratio:** Calculates the ratio of mitochondrial reads to nuclear reads (`MtNucRatioCalculator`)\n\n## 5. Genotyping\n* **Variant Analysis:** Performs variant calling to generate VCF files (`FreeBayes`)\n* **Variant Statistics:** Calculates statistics for the generated variants (`Bcftools stats`)\n\n## 6. Metagenomic Screening (For Unmapped Reads)\n* **Read Extraction:** Extracts unmapped reads for microbial analysis (`Picard SamToFastq`)\n* **Quality Filter:** Filters low-complexity sequences (`BBTools BBduk`)\n* **Taxonomic Classification:** Performs microbiome/taxonomic screening without alignment (`Kraken2`)\n\n## 7. Reporting\n* **Summary Report:** Aggregates logs and statistics from all these tools into a single interactive HTML report (`MultiQC`)\n\n\n## Workflow Outputs\nUpon successful execution, the workflow explicitly highlights and provides the following final files for analysis:\n\n* **`MultiQC Report` :** An interactive HTML report aggregating QC and analysis logs from all tools.\n* **`QualiMap BamQC Report` :** A detailed HTML report containing mapping quality metrics, GC content, and coverage statistics.\n* **`mapDamage Visualisation` :** Visual plots displaying the characteristic C-to-T deamination patterns at the ends of ancient DNA reads.\n* **`Kraken2 Report `:** A tabular report showing the taxonomic classification of unmapped reads.\n* **`EndorSpy Report `:** A JSON file containing the calculated endogenous DNA percentage.\n* **`Sex.DetERRmine Report` :** A JSON file containing relative chromosomal coverage and the calculated biological sex metrics.\n* **`Mt/Nuc Ratio Report` :** A JSON file containing the calculated ratio between mitochondrial and nuclear reads.\n* **`ANGSD Contamination Report` :** A tabular text file detailing the estimates of nuclear X-chromosome contamination.\n* **`Bcftools Stats Report` :** A text file containing comprehensive summary statistics for the called variants (VCF).\n\n\n## Testing Data\nTo ensure the workflow functions correctly, it was validated using the following datasets and databases:\n\n* **`Primary Test Data` :** The [JK2067](https://github.com/nf-core/test-datasets/blob/eager/testdata/Human/bam/JK2067.bam) BAM file (HiSeq 1240k captured UDG-half single-end libraries containing approximately 10,000 reads post-clipping) obtained from Lamnidis et al., 2018, Nat. Comms.\n* **`Primary Reference Genome` :** The [hs37d5_chr21-MT.fa.gz](https://github.com/nf-core/test-datasets/blob/eager/reference/Human/hs37d5_chr21-MT.fa.gz) file was utilized as the primary reference genome sequence.\n* **`X-Chromosome Contamination Reference` :** The [HapMap ChrX](https://github.com/ANGSD/angsd/blob/master/RES/HapMapChrX.gz) dataset was provided as the initial reference for the estimation of X-chromosome contamination using the ANGSD tool.\n* **`Taxonomic Classification Database` :** The Minikraken v2 database was utilized to perform taxonomic classification via Kraken2.", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "Input FASTQ reads (single-end or paired-end) for the sample.", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "Input FASTQ reads (single-end or paired-end) for the sample.", + "name": "InputReads" + } + ], + "label": "InputReads", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0, + "top": 0 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "f9a7939b-414a-437a-91b8-cdbfb17a0203", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "Reference genome sequence in FASTA format.", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "Reference genome sequence in FASTA format.", + "name": "ReferenceGenome" + } + ], + "label": "ReferenceGenome", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 600, + "top": 2180 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "ce609edc-8e3a-4a48-8599-217da2720699", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "HapMap dataset required for X-chromosome contamination estimation in ANGSD.", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "HapMap dataset required for X-chromosome contamination estimation in ANGSD.", + "name": "HapMapChrXReference" + } + ], + "label": "HapMapChrXReference", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 2000, + "top": 1360 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "065dc0b0-f3a8-40f7-b433-d9073fb0a4fd", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_SamToFastq/3.1.1.0", + "errors": null, + "id": 3, + "input_connections": { + "inputFile": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "SamToFastq", + "outputs": [ + { + "name": "fq_single", + "type": "fastqsanger" + }, + { + "name": "interleaved_fastq", + "type": "fastqsanger" + }, + { + "name": "fq1", + "type": "fastqsanger" + }, + { + "name": "fq2", + "type": "fastqsanger" + }, + { + "name": "fq_u", + "type": "fastqsanger" + } + ], + "position": { + "left": 300, + "top": 0 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_SamToFastq/3.1.1.0", + "tool_shed_repository": { + "changeset_revision": "3f254c5ced1d", + "name": "picard", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"clipping_action\": \"\", \"clipping_attribute\": \"\", \"include_non_pf_reads\": true, \"include_non_primary_alignments\": true, \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"re_reverse\": true, \"read1_max_bases_to_write\": \"-1\", \"read1_trim\": \"0\", \"read2_max_bases_to_write\": \"-1\", \"read2_trim\": \"0\", \"single_or_paired\": \"se\", \"validation_stringency\": \"LENIENT\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.1.1.0", + "type": "tool", + "uuid": "c7a2e6ff-2b80-484e-b83a-52d0769d6a0a", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "errors": null, + "id": 4, + "input_connections": { + "input_file": { + "id": 3, + "output_name": "fq_single" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool FastQC", + "name": "adapters" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "contaminants" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "limits" + } + ], + "label": "FastQC (pre-Trimming)", + "name": "FastQC", + "outputs": [ + { + "name": "html_file", + "type": "html" + }, + { + "name": "text_file", + "type": "txt" + } + ], + "position": { + "left": 600, + "top": 0 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "tool_shed_repository": { + "changeset_revision": "2c64fded1286", + "name": "fastqc", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapters\": {\"__class__\": \"RuntimeValue\"}, \"contaminants\": {\"__class__\": \"RuntimeValue\"}, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"kmers\": \"7\", \"limits\": {\"__class__\": \"RuntimeValue\"}, \"min_length\": null, \"nogroup\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.74+galaxy1", + "type": "tool", + "uuid": "38c90015-94fe-4ec2-b260-c59eb5a5a6c1", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", + "errors": null, + "id": 5, + "input_connections": { + "input_type_cond|read1": { + "id": 3, + "output_name": "fq_single" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", + "name": "fastq_trimming_options" + }, + { + "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", + "name": "input_type_cond" + } + ], + "label": null, + "name": "AdapterRemoval: remove adapter sequences", + "outputs": [ + { + "name": "output_settings", + "type": "txt" + }, + { + "name": "output_truncated", + "type": "fastqsanger" + } + ], + "position": { + "left": 600, + "top": 330 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "40874f772ea1", + "name": "adapter_removal", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"fastq_merging_options\": {\"collapse\": false, \"minalignmentlength\": \"11\", \"collapse_deterministic\": false, \"collapse_conservatively\": false}, \"fastq_options\": {\"qualitymax\": \"41\", \"mask_degenerate_bases\": false, \"convert_uracils\": false}, \"fastq_trimming_options\": {\"adapter1\": \"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC\", \"adapter2\": \"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA\", \"adapter_list\": {\"__class__\": \"RuntimeValue\"}, \"minadapteroverlap\": \"1\", \"mm\": \"3.0\", \"shift\": \"2\", \"trim5p_cond\": {\"trim5p_param\": \"no\", \"__current_case__\": 0}, \"trim3p_cond\": {\"trim3p_param\": \"no\", \"__current_case__\": 0}, \"trimns\": true, \"maxns\": \"1000\", \"trimqualities\": true, \"sliding_window_cond\": {\"sliding_window_param\": \"no\", \"__current_case__\": 0}, \"minquality\": \"20\", \"preserve5p\": false, \"minlength\": \"30\", \"maxlength\": \"4294967295\"}, \"input_type_cond\": {\"input_type\": \"single\", \"__current_case__\": 0, \"read1\": {\"__class__\": \"ConnectedValue\"}}, \"output_select\": \"none\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3.4+galaxy0", + "type": "tool", + "uuid": "df891e41-1311-41ff-821d-6defc40909f2", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "errors": null, + "id": 6, + "input_connections": { + "input_file": { + "id": 5, + "output_name": "output_truncated" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool FastQC", + "name": "adapters" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "contaminants" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "limits" + } + ], + "label": "FastQC (post-Trimming)", + "name": "FastQC", + "outputs": [ + { + "name": "html_file", + "type": "html" + }, + { + "name": "text_file", + "type": "txt" + } + ], + "position": { + "left": 950, + "top": 350 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "tool_shed_repository": { + "changeset_revision": "2c64fded1286", + "name": "fastqc", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapters\": {\"__class__\": \"RuntimeValue\"}, \"contaminants\": {\"__class__\": \"RuntimeValue\"}, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"kmers\": \"7\", \"limits\": {\"__class__\": \"RuntimeValue\"}, \"min_length\": null, \"nogroup\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.74+galaxy1", + "type": "tool", + "uuid": "e92ef1a3-fb16-4433-9fea-ff63fb6f8c7b", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa/0.7.19", + "errors": null, + "id": 7, + "input_connections": { + "input_type|fastq_input1": { + "id": 5, + "output_name": "output_truncated" + }, + "reference_source|ref_file": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map with BWA", + "name": "input_type" + }, + { + "description": "runtime parameter for tool Map with BWA", + "name": "reference_source" + } + ], + "label": null, + "name": "Map with BWA", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 950, + "top": 680 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa/0.7.19", + "tool_shed_repository": { + "changeset_revision": "1dfc975b48d5", + "name": "bwa", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 1, \"n\": \"0.01\", \"o\": \"2\", \"e\": \"-1\", \"i\": \"5\", \"d\": \"10\", \"l\": \"1024\", \"k\": \"2\", \"m\": \"2000000\", \"M\": \"3\", \"O\": \"11\", \"E\": \"4\", \"R\": \"30\", \"q\": \"0\", \"B\": null, \"L\": null}, \"input_type\": {\"input_type_selector\": \"single\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"adv_se_options\": {\"adv_se_options_selector\": \"do_not_set\", \"__current_case__\": 1}}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"set\", \"__current_case__\": 1, \"read_group_id_conditional\": {\"do_auto_name\": true, \"__current_case__\": 0}, \"read_group_sm_conditional\": {\"do_auto_name\": true, \"__current_case__\": 0}, \"PL\": \"ILLUMINA\", \"read_group_lb_conditional\": {\"do_auto_name\": true, \"__current_case__\": 0}, \"CN\": null, \"DS\": null, \"DT\": null, \"FO\": null, \"KS\": null, \"PG\": null, \"PI\": null, \"PU\": null}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.7.19", + "type": "tool", + "uuid": "d099da6f-ba0d-472d-a27e-4b121b232b8a", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/preseq_c_curve/preseq_c_curve/3.2.0+galaxy0", + "errors": null, + "id": 8, + "input_connections": { + "input_bam": { + "id": 7, + "output_name": "bam_output" + } + }, + "inputs": [], + "label": null, + "name": "Preseq c_curve", + "outputs": [ + { + "name": "output_tsv", + "type": "tsv" + } + ], + "position": { + "left": 1250, + "top": 530 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/preseq_c_curve/preseq_c_curve/3.2.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "d8b00ebb1567", + "name": "preseq_c_curve", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"max_read_len\": null, \"step_size\": \"1000\", \"verbose\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.2.0+galaxy0", + "type": "tool", + "uuid": "04647156-f324-4bee-9980-409dc4465778", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", + "errors": null, + "id": 9, + "input_connections": { + "input1": { + "id": 7, + "output_name": "bam_output" + } + }, + "inputs": [], + "label": null, + "name": "Samtools flagstat", + "outputs": [ + { + "name": "output1", + "type": "txt" + } + ], + "position": { + "left": 1250, + "top": 680 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", + "tool_shed_repository": { + "changeset_revision": "a0d8e49a018c", + "name": "samtools_flagstat", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"output_fmt\": \"txt\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.0.8", + "type": "tool", + "uuid": "e6e00757-2bb0-4b04-9d77-c9f743aa919e", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.22+galaxy1", + "errors": null, + "id": 10, + "input_connections": { + "input": { + "id": 7, + "output_name": "bam_output" + } + }, + "inputs": [], + "label": null, + "name": "Samtools view", + "outputs": [ + { + "name": "outputsam", + "type": "input" + }, + { + "name": "invoutputsam", + "type": "input" + } + ], + "position": { + "left": 1250, + "top": 940 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.22+galaxy1", + "tool_shed_repository": { + "changeset_revision": "5ec526530725", + "name": "samtools_view", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mode\": {\"outtype\": \"selected_reads\", \"__current_case__\": 1, \"filter_config\": {\"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"cond_rg\": {\"select_rg\": \"no\", \"__current_case__\": 0}, \"cond_expr\": {\"select_expr\": \"no\", \"__current_case__\": 0}, \"quality\": \"0\", \"library\": null, \"cigarcons\": null, \"inclusive_filter\": null, \"exclusive_filter\": [\"4\"], \"exclusive_filter_all\": null, \"tag\": null, \"qname_file\": {\"__class__\": \"RuntimeValue\"}}, \"subsample_config\": {\"subsampling_mode\": {\"select_subsample\": \"fraction\", \"__current_case__\": 0, \"factor\": \"1.0\", \"seed\": null}}, \"output_options\": {\"reads_report_type\": \"retained\", \"__current_case__\": 0, \"complementary_output\": true, \"adv_output\": {\"readtags\": [], \"collapsecigar\": false}, \"output_format\": {\"oformat\": \"bam\", \"__current_case__\": 2}}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy1", + "type": "tool", + "uuid": "36ba5b51-e8f0-48e7-a4ce-4f737501983f", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", + "errors": null, + "id": 11, + "input_connections": { + "input1": { + "id": 10, + "output_name": "outputsam" + } + }, + "inputs": [], + "label": "Samtools flagstat after filter", + "name": "Samtools flagstat", + "outputs": [ + { + "name": "output1", + "type": "txt" + } + ], + "position": { + "left": 1600, + "top": 730 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", + "tool_shed_repository": { + "changeset_revision": "a0d8e49a018c", + "name": "samtools_flagstat", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"output_fmt\": \"txt\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.0.8", + "type": "tool", + "uuid": "319fb62c-c9a7-4a33-8376-0c50eb506cc4", + "when": null, + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", + "errors": null, + "id": 12, + "input_connections": { + "inputFile": { + "id": 10, + "output_name": "outputsam" + } + }, + "inputs": [], + "label": null, + "name": "MarkDuplicates", + "outputs": [ + { + "name": "metrics_file", + "type": "txt" + }, + { + "name": "outFile", + "type": "bam" + } + ], + "position": { + "left": 1600, + "top": 940 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", + "tool_shed_repository": { + "changeset_revision": "3f254c5ced1d", + "name": "picard", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"assume_sorted\": true, \"barcode_tag\": null, \"comments\": [], \"duplicate_scoring_strategy\": \"SUM_OF_BASE_QUALITIES\", \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"optical_duplicate_pixel_distance\": \"100\", \"read_name_regex\": \"\", \"remove_duplicates\": true, \"validation_stringency\": \"SILENT\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.1.1.0", + "type": "tool", + "uuid": "8c03718a-0bad-48be-80de-138664f66696", + "when": null, + "workflow_outputs": [] + }, + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_SamToFastq/3.1.1.0", + "errors": null, + "id": 13, + "input_connections": { + "inputFile": { + "id": 10, + "output_name": "invoutputsam" + } + }, + "inputs": [], + "label": null, + "name": "SamToFastq", + "outputs": [ + { + "name": "fq_single", + "type": "fastqsanger" + }, + { + "name": "interleaved_fastq", + "type": "fastqsanger" + }, + { + "name": "fq1", + "type": "fastqsanger" + }, + { + "name": "fq2", + "type": "fastqsanger" + }, + { + "name": "fq_u", + "type": "fastqsanger" + } + ], + "position": { + "left": 1600, + "top": 1500 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_SamToFastq/3.1.1.0", + "tool_shed_repository": { + "changeset_revision": "3f254c5ced1d", + "name": "picard", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"clipping_action\": \"\", \"clipping_attribute\": \"\", \"include_non_pf_reads\": false, \"include_non_primary_alignments\": false, \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"re_reverse\": true, \"read1_max_bases_to_write\": \"-1\", \"read1_trim\": \"0\", \"read2_max_bases_to_write\": \"-1\", \"read2_trim\": \"0\", \"single_or_paired\": \"se\", \"validation_stringency\": \"LENIENT\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.1.1.0", + "type": "tool", + "uuid": "946af0e8-31b3-4670-beae-9ad33974ffcd", + "when": null, + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/endorspy/endorspy/1.3+galaxy0", + "errors": null, + "id": 14, + "input_connections": { + "post_flagstat": { + "id": 11, + "output_name": "output1" + }, + "pre_flagstat": { + "id": 9, + "output_name": "output1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool EndorSpy", + "name": "dedup_flagstat" + } + ], + "label": null, + "name": "EndorSpy", + "outputs": [ + { + "name": "output_json", + "type": "json" + } + ], + "position": { + "left": 2000, + "top": 370 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/endorspy/endorspy/1.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "6a999abf5fd4", + "name": "endorspy", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"dedup_flagstat\": {\"__class__\": \"RuntimeValue\"}, \"post_flagstat\": {\"__class__\": \"ConnectedValue\"}, \"pre_flagstat\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.3+galaxy0", + "type": "tool", + "uuid": "4ff74f9e-6ebd-4d5b-9ea1-f9d67edf3c0f", + "when": null, + "workflow_outputs": [ + { + "label": "EndorSpyReport", + "output_name": "output_json", + "uuid": "d95c7110-e27a-4c77-904e-15e88ad8c702" + } + ] + }, + "15": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd/0.940+galaxy0", + "errors": null, + "id": 15, + "input_connections": { + "input_bams": { + "id": 12, + "output_name": "outFile" + } + }, + "inputs": [], + "label": null, + "name": "ANGSD", + "outputs": [ + { + "name": "output_icnts", + "type": "gz" + } + ], + "position": { + "left": 2000, + "top": 580 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd/0.940+galaxy0", + "tool_shed_repository": { + "changeset_revision": "7b0e59047b2f", + "name": "angsd", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_bams\": {\"__class__\": \"ConnectedValue\"}, \"min_mapq\": \"30\", \"min_q\": \"30\", \"region\": \"X:5000000-154900000\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.940+galaxy0", + "type": "tool", + "uuid": "14301510-0957-4dd6-a410-9f3495de2bda", + "when": null, + "workflow_outputs": [] + }, + "16": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", + "errors": null, + "id": 16, + "input_connections": { + "input_bam": { + "id": 12, + "output_name": "outFile" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Sex.DetERRmine", + "name": "input_bed" + } + ], + "label": null, + "name": "Sex.DetERRmine", + "outputs": [ + { + "name": "output_report", + "type": "tabular" + }, + { + "name": "output_json", + "type": "json" + } + ], + "position": { + "left": 2000, + "top": 730 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", + "tool_shed_repository": { + "changeset_revision": "cf3d9775d7ae", + "name": "sexdeterrmine", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"base_quality\": \"30\", \"generate_json\": true, \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"input_bed\": {\"__class__\": \"RuntimeValue\"}, \"map_quality\": \"30\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.2+galaxy1", + "type": "tool", + "uuid": "4e668417-4ec2-4c9e-a980-7ac9798221b1", + "when": null, + "workflow_outputs": [ + { + "label": "SexdetERRmineReport", + "output_name": "output_json", + "uuid": "bcf1b833-8878-4610-be21-42045cdb1684" + } + ] + }, + "17": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/mtnucratio/mtnucratio/0.7.1+galaxy0", + "errors": null, + "id": 17, + "input_connections": { + "input_bam": { + "id": 12, + "output_name": "outFile" + } + }, + "inputs": [], + "label": null, + "name": "Mt/Nuc Ratio Calculator", + "outputs": [ + { + "name": "output_report", + "type": "txt" + }, + { + "name": "output_json", + "type": "json" + } + ], + "position": { + "left": 2000, + "top": 960 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/mtnucratio/mtnucratio/0.7.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "bac089482cef", + "name": "mtnucratio", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"mt_chrom_name\": \"MT\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.7.1+galaxy0", + "type": "tool", + "uuid": "1e5805f8-b32c-4b3f-a1b0-9d812b6cece5", + "when": null, + "workflow_outputs": [ + { + "label": "MtNucReport", + "output_name": "output_json", + "uuid": "203d3d8a-85e4-4ad9-aa34-b8c5c08da9d6" + } + ] + }, + "18": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.3+galaxy0", + "errors": null, + "id": 18, + "input_connections": { + "input1": { + "id": 12, + "output_name": "outFile" + } + }, + "inputs": [], + "label": null, + "name": "QualiMap BamQC", + "outputs": [ + { + "name": "raw_data", + "type": "input" + }, + { + "name": "output_html", + "type": "html" + } + ], + "position": { + "left": 2000, + "top": 1160 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "30a201c9c310", + "name": "qualimap_bamqc", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"duplicate_skipping\": null, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"per_base_coverage\": false, \"plot_specific\": {\"n_bins\": \"400\", \"paint_chromosome_limits\": true, \"genome_gc_distr\": null, \"homopolymer_size\": \"3\"}, \"stats_regions\": {\"region_select\": \"all\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "df529c99-8475-4abe-b08d-6381fa1c7506", + "when": null, + "workflow_outputs": [ + { + "label": "BamQCReport", + "output_name": "output_html", + "uuid": "176b3596-a676-4776-96d1-f96bcbb55ba1" + } + ] + }, + "19": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_damage/map_damage/2.2.3+galaxy0", + "errors": null, + "id": 19, + "input_connections": { + "reference|history_reference": { + "id": 1, + "output_name": "output" + }, + "sbam_file": { + "id": 12, + "output_name": "outFile" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool mapDamage", + "name": "reference" + } + ], + "label": null, + "name": "mapDamage", + "outputs": [ + { + "name": "damage_visualisation", + "type": "input" + }, + { + "name": "runtime_log", + "type": "txt" + } + ], + "position": { + "left": 2000, + "top": 1670 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_damage/map_damage/2.2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "0287e2f82b64", + "name": "map_damage", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"downsampling\": {\"downsampling\": {\"downsampling_type\": \"no_downsampling\", \"__current_case__\": 0}}, \"fasta\": false, \"graphics\": {\"ymax\": \"0.3\", \"readplot\": \"25\", \"refplot\": \"10\", \"title\": null, \"theme_bw\": \"\"}, \"merge_reference_sequences\": false, \"min_basequal\": \"0\", \"reference\": {\"ref_source\": \"history\", \"__current_case__\": 1, \"history_reference\": {\"__class__\": \"ConnectedValue\"}}, \"rescale\": {\"rescaling\": {\"rescale\": \"\", \"__current_case__\": 1}}, \"sbam_file\": {\"__class__\": \"ConnectedValue\"}, \"statistics\": {\"stats\": {\"no_stats\": \"--no-stats\", \"__current_case__\": 1}}, \"window_size\": {\"length\": \"70\", \"around\": \"10\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.2.3+galaxy0", + "type": "tool", + "uuid": "b42619df-22e0-4bf2-9280-c9903b2edd54", + "when": null, + "workflow_outputs": [ + { + "label": "DamageVisualisation", + "output_name": "damage_visualisation", + "uuid": "1e565382-1ccc-49ac-951a-91a3bfbe86bf" + } + ] + }, + "20": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/freebayes/freebayes/1.3.10+galaxy1", + "errors": null, + "id": 20, + "input_connections": { + "reference_source|batchmode|input_bams": { + "id": 12, + "output_name": "outFile" + }, + "reference_source|ref_file": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool FreeBayes", + "name": "reference_source" + } + ], + "label": null, + "name": "FreeBayes", + "outputs": [ + { + "name": "output_vcf", + "type": "vcf" + } + ], + "position": { + "left": 2000.1295929540572, + "top": 2013.447603782008 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/freebayes/freebayes/1.3.10+galaxy1", + "tool_shed_repository": { + "changeset_revision": "0d8581534009", + "name": "freebayes", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"coverage_options\": {\"coverage_options_selector\": \"set\", \"__current_case__\": 0, \"min_coverage\": \"0\", \"limit_coverage\": \"0\", \"skip_coverage\": \"0\"}, \"options_type\": {\"options_type_selector\": \"full\", \"__current_case__\": 0, \"optional_inputs\": {\"optional_inputs_selector\": \"do_not_set\", \"__current_case__\": 1}, \"reporting\": {\"reporting_selector\": \"do_not_set\", \"__current_case__\": 1}, \"population_model\": {\"population_model_selector\": \"set\", \"__current_case__\": 0, \"T\": \"0.01\", \"P\": \"2\", \"J\": false, \"K\": false}, \"reference_allele\": {\"reference_allele_selector\": \"do_not_set\", \"__current_case__\": 1}, \"allele_scope\": {\"allele_scope_selector\": \"do_not_set\", \"__current_case__\": 1}, \"O\": false, \"input_filters\": {\"input_filters_selector\": \"set\", \"__current_case__\": 0, \"standard_filters\": false, \"use_duplicate_reads\": false, \"min_mapping_quality\": \"1\", \"min_base_quality\": \"0\", \"min_supporting_allele_qsum\": \"0\", \"min_supporting_mapping_qsum\": \"0\", \"mismatch_filters\": {\"mismatch_filters_selector\": \"do_not_set\", \"__current_case__\": 1}, \"read_indel_limit\": \"1000\", \"min_alternate_fraction\": \"0.05\", \"min_alternate_qsum\": \"0\", \"min_alternate_count\": \"1\", \"min_alternate_total\": \"1\"}, \"population_mappability_priors\": {\"population_mappability_priors_selector\": \"do_not_set\", \"__current_case__\": 1}, \"genotype_likelihoods\": {\"genotype_likelihoods_selector\": \"do_not_set\", \"__current_case__\": 1}, \"algorithmic_features\": {\"algorithmic_features_selector\": \"do_not_set\", \"__current_case__\": 1}}, \"output_options\": {\"flavor\": \"vcf\", \"__current_case__\": 0}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"batchmode\": {\"processmode\": \"individual\", \"__current_case__\": 0, \"input_bams\": {\"__class__\": \"RuntimeValue\"}}, \"ref_file\": {\"__class__\": \"RuntimeValue\"}}, \"target_limit_type\": {\"target_limit_type_selector\": \"do_not_limit\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.3.10+galaxy1", + "type": "tool", + "uuid": "2d59df66-a044-46f7-baa7-7da73293a238", + "when": null, + "workflow_outputs": [] + }, + "21": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bbtools_bbduk/bbtools_bbduk/39.08+galaxy4", + "errors": null, + "id": 21, + "input_connections": { + "input_type_cond|read1": { + "id": 13, + "output_name": "fq_single" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool BBTools: BBduk", + "name": "input_type_cond" + } + ], + "label": null, + "name": "BBTools: BBduk", + "outputs": [ + { + "name": "outputu", + "type": "fastqsanger" + } + ], + "position": { + "left": 2000, + "top": 1500 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bbtools_bbduk/bbtools_bbduk/39.08+galaxy4", + "tool_shed_repository": { + "changeset_revision": "428de92eac6b", + "name": "bbtools_bbduk", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advanced_options\": {\"k\": \"27\", \"rcomp\": false, \"maskmiddle\": false, \"minkmerhits\": \"1\", \"minkmerfraction\": \"0.0\", \"mincovfraction\": \"0.0\", \"hammingdistance\": \"0\", \"qhdist\": \"0\", \"editdistance\": \"0\", \"forbidn\": false, \"trimfailures\": false, \"findbestmatch\": false, \"skipr1\": false, \"skipr2\": false, \"entropy\": \"0.3\", \"entropymask\": \"f\", \"entropywindow\": \"50\", \"entropyk\": \"5\"}, \"input_type_cond\": {\"input_type\": \"single\", \"__current_case__\": 0, \"read1\": {\"__class__\": \"ConnectedValue\"}}, \"log_file\": false, \"output_hists_cond\": {\"output_hists\": \"no\", \"__current_case__\": 0}, \"output_stats_cond\": {\"output_stats\": \"no\", \"__current_case__\": 0}, \"outputs_select\": \"outu\", \"reference_type_cond\": {\"reference_type\": \"no_reference\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "39.08+galaxy4", + "type": "tool", + "uuid": "b7addfcb-9333-463c-8976-bb4d9c310f31", + "when": null, + "workflow_outputs": [] + }, + "22": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd_contamination/0.940+galaxy0", + "errors": null, + "id": 22, + "input_connections": { + "hapmap_file": { + "id": 2, + "output_name": "output" + }, + "icnts_file": { + "id": 15, + "output_name": "output_icnts" + } + }, + "inputs": [], + "label": null, + "name": "ANGSD X-Contamination", + "outputs": [ + { + "name": "output_txt", + "type": "tabular" + } + ], + "position": { + "left": 2300, + "top": 1280 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd_contamination/0.940+galaxy0", + "tool_shed_repository": { + "changeset_revision": "7b0e59047b2f", + "name": "angsd", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"generate_json\": false, \"hapmap_file\": {\"__class__\": \"ConnectedValue\"}, \"icnts_file\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.940+galaxy0", + "type": "tool", + "uuid": "f47efc7e-ac0c-48fa-91f2-70fa86a26230", + "when": null, + "workflow_outputs": [ + { + "label": "ANGSDReport", + "output_name": "output_txt", + "uuid": "9e836184-d45a-450f-a377-f7d00c5b1364" + } + ] + }, + "23": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_stats/bcftools_stats/1.22+galaxy0", + "errors": null, + "id": 23, + "input_connections": { + "input_file": { + "id": 20, + "output_name": "output_vcf" + }, + "sec_default|reference_source|fasta_ref": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool bcftools stats", + "name": "inputB_file" + }, + { + "description": "runtime parameter for tool bcftools stats", + "name": "sec_default" + }, + { + "description": "runtime parameter for tool bcftools stats", + "name": "sec_restrict" + } + ], + "label": null, + "name": "bcftools stats", + "outputs": [ + { + "name": "output_file", + "type": "txt" + } + ], + "position": { + "left": 2300, + "top": 2120 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_stats/bcftools_stats/1.22+galaxy0", + "tool_shed_repository": { + "changeset_revision": "fcf941c241cc", + "name": "bcftools_stats", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"inputB_file\": {\"__class__\": \"RuntimeValue\"}, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"plot_title\": \"\", \"sec_default\": {\"first_allele_only\": false, \"depth\": {\"set_depth\": \"no\", \"__current_case__\": 0}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 2, \"fasta_ref\": {\"__class__\": \"ConnectedValue\"}}, \"exons_file\": {\"__class__\": \"RuntimeValue\"}, \"split_by_ID\": false, \"user_tstv\": \"\", \"afbins\": {\"afbins_select\": \"default\", \"__current_case__\": 0}, \"af_tag\": \"\", \"verbose\": false}, \"sec_restrict\": {\"samples\": \"\", \"invert_samples\": false, \"samples_file\": {\"__class__\": \"RuntimeValue\"}, \"invert_samples_file\": false, \"apply_filters\": \"\", \"collapse\": null, \"regions\": {\"regions_src\": \"__none__\", \"__current_case__\": 0}, \"targets\": {\"targets_src\": \"__none__\", \"__current_case__\": 0}, \"include\": null, \"exclude\": null}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy0", + "type": "tool", + "uuid": "5e982d4e-fc9f-4b15-8b85-e8298378d320", + "when": null, + "workflow_outputs": [ + { + "label": "bcftoolsReport", + "output_name": "output_file", + "uuid": "c2bb495b-0257-4d57-8920-725a1a14628f" + } + ] + }, + "24": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/kraken2/kraken2/2.17.1+galaxy0", + "errors": null, + "id": 24, + "input_connections": { + "single_paired|input_sequences": { + "id": 21, + "output_name": "outputu" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Kraken2", + "name": "single_paired" + } + ], + "label": null, + "name": "Kraken2", + "outputs": [ + { + "name": "report_output", + "type": "tabular" + }, + { + "name": "output", + "type": "tabular" + } + ], + "position": { + "left": 2300.000115313445, + "top": 1498.4843461922294 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/kraken2/kraken2/2.17.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "cbe396d9773e", + "name": "kraken2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"confidence\": \"0.0\", \"kraken2_database\": \"2026-02-13T204037Z_minikraken2_v2_8GB\", \"min_base_quality\": \"0\", \"minimum_hit_groups\": \"2\", \"quick\": false, \"report\": {\"create_report\": \"true\", \"__current_case__\": 0, \"use_mpa_style\": false, \"report_zero_counts\": false, \"report_minimizer_data\": true}, \"single_paired\": {\"single_paired_selector\": \"no\", \"__current_case__\": 1, \"input_sequences\": {\"__class__\": \"ConnectedValue\"}}, \"split_reads\": false, \"use_names\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.17.1+galaxy0", + "type": "tool", + "uuid": "72c51a71-193c-48a7-a2e3-c9186a602e45", + "when": null, + "workflow_outputs": [ + { + "label": "Kraken2Report", + "output_name": "report_output", + "uuid": "fde3b893-28ea-4608-a36d-1b1ea38bc026" + } + ] + }, + "25": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.34+galaxy0", + "errors": null, + "id": 25, + "input_connections": { + "results_0|software_cond|output_0|input": { + "id": 4, + "output_name": "text_file" + }, + "results_10|software_cond|input": { + "id": 19, + "output_name": "damage_visualisation" + }, + "results_11|software_cond|input": { + "id": 23, + "output_name": "output_file" + }, + "results_1|software_cond|input": { + "id": 5, + "output_name": "output_settings" + }, + "results_2|software_cond|output_0|input": { + "id": 6, + "output_name": "text_file" + }, + "results_3|software_cond|input": { + "id": 8, + "output_name": "output_tsv" + }, + "results_4|software_cond|output_0|type|input": { + "id": 9, + "output_name": "output1" + }, + "results_5|software_cond|output_0|type|input": { + "id": 11, + "output_name": "output1" + }, + "results_6|software_cond|output_0|input": { + "id": 12, + "output_name": "metrics_file" + }, + "results_7|software_cond|input": { + "id": 16, + "output_name": "output_json" + }, + "results_8|software_cond|input": { + "id": 18, + "output_name": "raw_data" + }, + "results_9|software_cond|input": { + "id": 24, + "output_name": "report_output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool MultiQC", + "name": "image_content_input" + } + ], + "label": null, + "name": "MultiQC", + "outputs": [ + { + "name": "html_report", + "type": "html" + }, + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 2925.562544551844, + "top": 288.17191621094787 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.34+galaxy0", + "tool_shed_repository": { + "changeset_revision": "371299578b8e", + "name": "multiqc", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"comment\": \"\", \"export\": false, \"flat\": false, \"image_content_input\": {\"__class__\": \"RuntimeValue\"}, \"png_plots\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"fastqc\", \"__current_case__\": 9, \"output\": [{\"__index__\": 0, \"type\": \"data\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"adapterremoval\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"fastqc\", \"__current_case__\": 9, \"output\": [{\"__index__\": 0, \"type\": \"data\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 3, \"software_cond\": {\"software\": \"preseq\", \"__current_case__\": 44, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 4, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 25, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"flagstat\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}, {\"__index__\": 5, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 25, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"flagstat\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}, {\"__index__\": 6, \"software_cond\": {\"software\": \"picard\", \"__current_case__\": 18, \"output\": [{\"__index__\": 0, \"type\": \"markdups\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 7, \"software_cond\": {\"software\": \"sexdeterrmine\", \"__current_case__\": 43, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 8, \"software_cond\": {\"software\": \"qualimap\", \"__current_case__\": 21, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 9, \"software_cond\": {\"software\": \"kraken\", \"__current_case__\": 34, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 10, \"software_cond\": {\"software\": \"mapdamage\", \"__current_case__\": 45, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 11, \"software_cond\": {\"software\": \"bcftools\", \"__current_case__\": 2, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"title\": \"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.34+galaxy0", + "type": "tool", + "uuid": "c2f12730-493a-447e-83c1-bb255f5d93ef", + "when": null, + "workflow_outputs": [ + { + "label": "MultiQCReport", + "output_name": "html_report", + "uuid": "427a3f87-3626-493f-b137-ba257a1e6ea0" + } + ] + } + }, + "tags": [], + "uuid": "21f27328-944e-42ff-9019-598922fc5a04", + "version": 64 +} \ No newline at end of file From b5c54f55019d0226dc4907c6c9eea3f1d89ab838 Mon Sep 17 00:00:00 2001 From: Ubuntu Date: Mon, 18 May 2026 14:59:07 +0000 Subject: [PATCH 02/17] Apply reviewer feedback: add BWA/Bowtie2 switch, optional HapMap/BED, expose parameters, descriptive outputs, and lowercase filenames --- .../paleogenomics/aDNA-analysis/README.md | 72 -- .../.dockstore.yml | 6 +- .../CHANGELOG.md | 2 +- .../paleogenomics/adna-analysis/README.md | 79 ++ .../adna-analysis-tests.yml} | 45 +- .../adna-analysis.ga} | 1090 +++++++++++++---- 6 files changed, 929 insertions(+), 365 deletions(-) delete mode 100644 workflows/paleogenomics/aDNA-analysis/README.md rename workflows/paleogenomics/{aDNA-analysis => adna-analysis}/.dockstore.yml (64%) rename workflows/paleogenomics/{aDNA-analysis => adna-analysis}/CHANGELOG.md (57%) create mode 100644 workflows/paleogenomics/adna-analysis/README.md rename workflows/paleogenomics/{aDNA-analysis/aDNA-analysis-tests.yml => adna-analysis/adna-analysis-tests.yml} (58%) rename workflows/paleogenomics/{aDNA-analysis/aDNA-analysis.ga => adna-analysis/adna-analysis.ga} (58%) diff --git a/workflows/paleogenomics/aDNA-analysis/README.md b/workflows/paleogenomics/aDNA-analysis/README.md deleted file mode 100644 index 7868f47c63..0000000000 --- a/workflows/paleogenomics/aDNA-analysis/README.md +++ /dev/null @@ -1,72 +0,0 @@ -# Ancient DNA analysis pipeline -This workflow performs an ancient DNA (aDNA) based analysis similar to the one in the [nf-core/eager](https://nf-co.re/eager/2.5.3/) workflow. nf-core/eager is a bioinformatics best-practise processing pipeline for genomic NGS sequencing data, with a focus on ancient DNA data. It is ideal for the (palaeo)genomic analysis of humans, animals, plants, microbes and even microbiomes. - -The pipeline pre-processes raw data from FASTQ inputs, or preprocessed BAM inputs. It can align reads and performs extensive general NGS and aDNA specific quality-control on the results. - - -## Required Inputs -To run this workflow successfully, you need to provide the following input datasets: - -* **`InputReads` :** The raw sequencing data for your sample in `FASTQ` format. The workflow supports both single-end and paired-end reads. -* **`ReferenceGenome` :** The reference genome sequence for your target organism in `FASTA` format. This is essential for read mapping (BWA) and variant calling. -* **`HapMapChrXReference` :** A reference HapMap dataset file. This is required by the ANGSD tool to estimate nuclear X-chromosome contamination in human ancient DNA samples. - - -## Workflow Steps -By default the pipeline currently performs the following: - -## 1. Preprocessing and Quality Control -* **Format Conversion:** Converts input files from BAM/SAM format to FASTQ format (`Picard SamToFastq`) -* **Quality Control:** Evaluates read quality before and after trimming (`FastQC`) -* **Adapter Trimming:** Removes adapter sequences and merges paired-end reads (`AdapterRemoval`) - -## 2. Read Mapping and Processing -* **Alignment:** Maps reads to the provided reference genome (`BWA`) -* **Filtering and Statistics:** Separates unmapped reads and calculates alignment statistics (`Samtools View and Flagstat`) -* **Duplicate Removal:** Detects and marks PCR duplicates (`Picard MarkDuplicates`) -* **Alignment Quality:** Generates detailed BAM quality metrics (`QualiMap BamQC`) -* **Library Complexity:** Estimates library complexity (`Preseq`) - -## 3. Ancient DNA (aDNA) Analysis -* **Damage Profiling:** Visualizes aDNA-specific C-to-T damage patterns (`mapDamage`) -* **Endogenous Content:** Calculates the proportion of endogenous (target) DNA in the sample (`EndorSpy`) -* **Contamination:** Estimates nuclear X-chromosome contamination using HapMap data (`ANGSD X-Contamination`) - -## 4. Biological Information -* **Sex Determination:** Determines biological sex based on relative chromosome coverage ratio (`Sex.DetERRmine`) -* **Mt/Nuc Ratio:** Calculates the ratio of mitochondrial reads to nuclear reads (`MtNucRatioCalculator`) - -## 5. Genotyping -* **Variant Analysis:** Performs variant calling to generate VCF files (`FreeBayes`) -* **Variant Statistics:** Calculates statistics for the generated variants (`Bcftools stats`) - -## 6. Metagenomic Screening (For Unmapped Reads) -* **Read Extraction:** Extracts unmapped reads for microbial analysis (`Picard SamToFastq`) -* **Quality Filter:** Filters low-complexity sequences (`BBTools BBduk`) -* **Taxonomic Classification:** Performs microbiome/taxonomic screening without alignment (`Kraken2`) - -## 7. Reporting -* **Summary Report:** Aggregates logs and statistics from all these tools into a single interactive HTML report (`MultiQC`) - - -## Workflow Outputs -Upon successful execution, the workflow explicitly highlights and provides the following final files for analysis: - -* **`MultiQC Report` :** An interactive HTML report aggregating QC and analysis logs from all tools. -* **`QualiMap BamQC Report` :** A detailed HTML report containing mapping quality metrics, GC content, and coverage statistics. -* **`mapDamage Visualisation` :** Visual plots displaying the characteristic C-to-T deamination patterns at the ends of ancient DNA reads. -* **`Kraken2 Report `:** A tabular report showing the taxonomic classification of unmapped reads. -* **`EndorSpy Report `:** A JSON file containing the calculated endogenous DNA percentage. -* **`Sex.DetERRmine Report` :** A JSON file containing relative chromosomal coverage and the calculated biological sex metrics. -* **`Mt/Nuc Ratio Report` :** A JSON file containing the calculated ratio between mitochondrial and nuclear reads. -* **`ANGSD Contamination Report` :** A tabular text file detailing the estimates of nuclear X-chromosome contamination. -* **`Bcftools Stats Report` :** A text file containing comprehensive summary statistics for the called variants (VCF). - - -## Testing Data -To ensure the workflow functions correctly, it was validated using the following datasets and databases: - -* **`Primary Test Data` :** The [JK2067](https://github.com/nf-core/test-datasets/blob/eager/testdata/Human/bam/JK2067.bam) BAM file (HiSeq 1240k captured UDG-half single-end libraries containing approximately 10,000 reads post-clipping) obtained from Lamnidis et al., 2018, Nat. Comms. -* **`Primary Reference Genome` :** The [hs37d5_chr21-MT.fa.gz](https://github.com/nf-core/test-datasets/blob/eager/reference/Human/hs37d5_chr21-MT.fa.gz) file was utilized as the primary reference genome sequence. -* **`X-Chromosome Contamination Reference` :** The [HapMap ChrX](https://github.com/ANGSD/angsd/blob/master/RES/HapMapChrX.gz) dataset was provided as the initial reference for the estimation of X-chromosome contamination using the ANGSD tool. -* **`Taxonomic Classification Database` :** The Minikraken v2 database was utilized to perform taxonomic classification via Kraken2. \ No newline at end of file diff --git a/workflows/paleogenomics/aDNA-analysis/.dockstore.yml b/workflows/paleogenomics/adna-analysis/.dockstore.yml similarity index 64% rename from workflows/paleogenomics/aDNA-analysis/.dockstore.yml rename to workflows/paleogenomics/adna-analysis/.dockstore.yml index 5065b9a4ac..e8c5ca5cbd 100644 --- a/workflows/paleogenomics/aDNA-analysis/.dockstore.yml +++ b/workflows/paleogenomics/adna-analysis/.dockstore.yml @@ -1,11 +1,11 @@ version: 1.2 workflows: -- name: aDNA-analysis +- name: adna-analysis subclass: Galaxy publish: true - primaryDescriptorPath: /aDNA-analysis.ga + primaryDescriptorPath: /adna-analysis.ga testParameterFiles: - - /aDNA-analysis-tests.yml + - /adna-analysis-tests.yml authors: - name: Ali Mert AYDIN orcid: "https://orcid.org/0009-0008-9038-0815" diff --git a/workflows/paleogenomics/aDNA-analysis/CHANGELOG.md b/workflows/paleogenomics/adna-analysis/CHANGELOG.md similarity index 57% rename from workflows/paleogenomics/aDNA-analysis/CHANGELOG.md rename to workflows/paleogenomics/adna-analysis/CHANGELOG.md index 06913e9995..4849f5e7c4 100644 --- a/workflows/paleogenomics/aDNA-analysis/CHANGELOG.md +++ b/workflows/paleogenomics/adna-analysis/CHANGELOG.md @@ -1,5 +1,5 @@ # Changelog -## [0.1] - 2026-05-09 +## [0.1] - 2026-05-18 - First release. \ No newline at end of file diff --git a/workflows/paleogenomics/adna-analysis/README.md b/workflows/paleogenomics/adna-analysis/README.md new file mode 100644 index 0000000000..721586faa5 --- /dev/null +++ b/workflows/paleogenomics/adna-analysis/README.md @@ -0,0 +1,79 @@ +# Ancient DNA analysis pipeline +This workflow performs an ancient DNA (aDNA) based analysis similar to the one in the [nf-core/eager](https://nf-co.re/eager/2.5.3/) workflow. nf-core/eager is a bioinformatics best-practice processing pipeline for genomic NGS sequencing data, with a focus on ancient DNA data. It is ideal for the (palaeo)genomic analysis of humans, animals, plants, microbes and even microbiomes. + +The pipeline processes the sequencing-read input provided to the workflow together with a reference genome and optional supporting reference data. It aligns reads and performs extensive general NGS and aDNA-specific quality control on the results. + + +## Required & Optional Inputs +To run this workflow successfully, you need to provide the following input datasets and parameters: + +* **`Input reads` :** Input single-end FASTQ reads for the sample. +* **`Reference genome` :** Reference genome sequence in FASTA format. This is essential for read mapping and variant calling. +* **`Choose Mapper` :** Switch to select the alignment tool. Choose between BWA and Bowtie2. +* **`Hap Map ChrX reference` :** HapMap dataset required for X-chromosome contamination estimation in ANGSD. +* **`Input Mitochondrial Chromosome Name` :** The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS). +* **`Kraken2 database directory` :** The database directory required for Kraken2 taxonomic classification. +* **`Optional BED file for Sex.DetERRmine` :** An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms. +* **`ANGSD region parameter` :** The specific genomic region to restrict the ANGSD analysis (typically 'X' for human male nuclear contamination estimation). + + +## Workflow Steps +By default the pipeline currently performs the following: + +## 1. Preprocessing and Quality Control +* **Quality Control:** Evaluates read quality before and after trimming (`FastQC`) +* **Adapter Trimming:** Removes adapter sequences (`AdapterRemoval`) + +## 2. Read Mapping and Processing +* **Alignment:** Maps reads to the provided reference genome conditionally using either (`BWA`) or (`Bowtie2`) based on user selection +* **Filtering and Statistics:** Separates unmapped reads and calculates alignment statistics (`Samtools View and Flagstat`) +* **Duplicate Removal:** Detects and marks PCR duplicates (`Picard MarkDuplicates`) +* **Alignment Quality:** Generates detailed BAM quality metrics (`QualiMap BamQC`) +* **Library Complexity:** Estimates library complexity (`Preseq`) + +## 3. Ancient DNA (aDNA) Analysis +* **Damage Profiling:** Visualizes aDNA-specific C-to-T damage patterns (`mapDamage`) +* **Endogenous Content:** Calculates the proportion of endogenous (target) DNA in the sample (`EndorSpy`) +* **(`Optional`) Contamination:** Estimates nuclear X-chromosome contamination conditionally if HapMap data is provided (`ANGSD X-Contamination`) + +## 4. Biological Information +* **Sex Determination:** Determines biological sex based on relative chromosome coverage ratio. This step adapts conditionally whether an optional BED file is provided (`Sex.DetERRmine`) +* **Mt/Nuc Ratio:** Calculates the ratio of mitochondrial reads to nuclear reads utilizing the specified mitochondrial chromosome name (`MtNucRatioCalculator`) + +## 5. Genotyping +* **Variant Analysis:** Performs variant calling to generate VCF files (`FreeBayes`) +* **Variant Statistics:** Calculates statistics for the generated variants (`Bcftools stats`) + +## 6. Metagenomic Screening (For Unmapped Reads) +* **Read Extraction:** Extracts unmapped reads for microbial analysis (`Picard SamToFastq`) +* **Quality Filter:** Filters low-complexity sequences (`BBTools BBduk`) +* **Taxonomic Classification:** Performs microbiome/taxonomic screening on the filtered unmapped reads (`Kraken2`) + +## 7. Reporting +* **Summary Report:** Aggregates logs and statistics from all these tools into a single interactive HTML report (`MultiQC`) + + +## Workflow Outputs +Upon successful execution, the workflow explicitly provides the following final files for analysis: + +* **`MultiQC aggregated workflow summary report` :** An interactive HTML report aggregating QC and analysis logs from all tools. +* **`QualiMap BamQC general alignment quality metrics report` :** A detailed HTML report containing mapping quality metrics, GC content, and coverage statistics. +* **`mapDamage Visualisation` :** Visual plots displaying the characteristic C-to-T deamination patterns at the ends of ancient DNA reads. +* **`Kraken2 taxonomic classification and microbial screening report` :** A tabular report showing the taxonomic classification of unmapped reads. +* **`EndorSpy endogenous DNA authentication report` :** A JSON file containing the calculated endogenous DNA percentage. +* **`Sex.DetERRmine (Without BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for human-genome alignments. +* **`Sex.DetERRmine (With BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for targeted capture regions. +* **`Mitochondrial to nuclear DNA ratio calculation report` :** A JSON file containing the calculated ratio between mitochondrial and nuclear reads. +* **`ANGSD report of nuclear contamination estimation` :** A tabular text file detailing the estimates of nuclear X-chromosome contamination. +* **`Bcftools variant calling summary statistics report` :** A text file containing comprehensive summary statistics for the called variants (VCF). +* **`Fully post-processed mapping results` :** The final deduplicated and filtered alignment BAM file. +* **`Freebayes raw genomic variant calls` :** The raw VCF file generated from variant analysis. + + +## Testing Data +To ensure the workflow functions correctly, it was validated using the following datasets and databases: + +* **`Primary Test Data` :** A downsampled single-end FASTQ dataset [NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz](https://zenodo.org/records/20271974/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz) optimized for rapid workflow testing and validation. +* **`Primary Reference Genome` :** The [hs37d5_chr21-MT.fa.gz](https://github.com/nf-core/test-datasets/blob/eager/reference/Human/hs37d5_chr21-MT.fa.gz) file was utilized as the primary reference genome sequence. +* **`X-Chromosome Contamination Reference` :** The [HapMap ChrX](https://github.com/ANGSD/angsd/blob/master/RES/HapMapChrX.gz) dataset was provided as the initial reference for the estimation of X-chromosome contamination using the ANGSD tool. +* **`Taxonomic Classification Database` :** The Minikraken v2 database was utilized to perform taxonomic classification via Kraken2. \ No newline at end of file diff --git a/workflows/paleogenomics/aDNA-analysis/aDNA-analysis-tests.yml b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml similarity index 58% rename from workflows/paleogenomics/aDNA-analysis/aDNA-analysis-tests.yml rename to workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml index 90faea0cbc..b1fc427d2d 100644 --- a/workflows/paleogenomics/aDNA-analysis/aDNA-analysis-tests.yml +++ b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml @@ -1,35 +1,42 @@ -- doc: Test outline for aDNA-analysis.ga +- doc: Test outline for adna-analysis.ga job: - InputReads: + Input reads: class: File - location: https://github.com/nf-core/test-datasets/raw/eager/testdata/Human/bam/JK2067.bam - filetype: bam - ReferenceGenome: + location: https://zenodo.org/records/20271974/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz + filetype: fastqsanger.gz + Reference genome: class: File location: https://github.com/nf-core/test-datasets/raw/eager/reference/Human/hs37d5_chr21-MT.fa.gz filetype: fasta.gz - HapMapChrXReference: + Hap Map ChrX reference: class: File location: https://github.com/ANGSD/angsd/raw/master/RES/HapMapChrX.gz filetype: gz + Choose Mapper: BWA + Optional BED file for Sex.DetERRmine: null + Kraken2 database directory: 2026-02-13T204037Z_minikraken2_v2_8GB outputs: - EndorSpyReport: + Fully post-processed mapping results: + asserts: + has_size: + min: 100 + EndorSpy endogenous DNA authentication report: asserts: has_text: text: "percent_on_target" - SexdetERRmineReport: + Sex.DetERRmine (Without BED) report of chromosomal gender estimation: asserts: has_text: text: "Sex.DetERRmine" - MtNucReport: + QualiMap BamQC general alignment quality metrics report: asserts: has_text: - text: "mtnuccalculator" - BamQCReport: + text: "Qualimap Report: BAM QC" + Mitochondrial to nuclear DNA ratio calculation report: asserts: has_text: - text: "Qualimap Report: BAM QC" - DamageVisualisation: + text: "mtnuccalculator" + mapDamage Visualisation: element_tests: dnacomp: asserts: @@ -59,19 +66,23 @@ asserts: has_size: min: 100 - ANGSDReport: + Freebayes raw genomic variant calls: + asserts: + has_text: + text: "freeBayes" + ANGSD report of nuclear contamination estimation: asserts: has_text: text: "Method1_MOM_estimate" - bcftoolsReport: + Bcftools variant calling summary statistics report: asserts: has_text: text: "ACT>TCGA" - Kraken2Report: + Kraken2 taxonomic classification and microbial screening report: asserts: has_text: text: "root" - MultiQCReport: + MultiQC aggregated workflow summary report: asserts: has_text: text: "MultiQC" diff --git a/workflows/paleogenomics/aDNA-analysis/aDNA-analysis.ga b/workflows/paleogenomics/adna-analysis/adna-analysis.ga similarity index 58% rename from workflows/paleogenomics/aDNA-analysis/aDNA-analysis.ga rename to workflows/paleogenomics/adna-analysis/adna-analysis.ga index 60f184108c..dc1b5ecb31 100644 --- a/workflows/paleogenomics/aDNA-analysis/aDNA-analysis.ga +++ b/workflows/paleogenomics/adna-analysis/adna-analysis.ga @@ -1,6 +1,6 @@ { "a_galaxy_workflow": "true", - "annotation": "This workflow performs an ancient DNA based analysis similar to the one in the nf-core/eager workflow", + "annotation": "This workflow performs ancient DNA analysis similar to the nf-core/eager workflow to analyze sequencing data and generate alignment and authentication results", "comments": [], "creator": [ { @@ -11,31 +11,30 @@ ], "format-version": "0.1", "license": "MIT", - "release": "0.1", "name": "Ancient DNA analysis", - "readme": "# Pipeline Summary\nThis workflow performs an ancient DNA (aDNA) based analysis similar to the one in the [nf-core/eager](https://nf-co.re/eager/2.5.3/) workflow. nf-core/eager is a bioinformatics best-practise processing pipeline for genomic NGS sequencing data, with a focus on ancient DNA data. It is ideal for the (palaeo)genomic analysis of humans, animals, plants, microbes and even microbiomes.\n\nThe pipeline pre-processes raw data from FASTQ inputs, or preprocessed BAM inputs. It can align reads and performs extensive general NGS and aDNA specific quality-control on the results.\n\n\n## Required Inputs\nTo run this workflow successfully, you need to provide the following input datasets:\n\n* **`InputReads` :** The raw sequencing data for your sample in `FASTQ` format. The workflow supports both single-end and paired-end reads.\n* **`ReferenceGenome` :** The reference genome sequence for your target organism in `FASTA` format. This is essential for read mapping (BWA) and variant calling.\n* **`HapMapChrXReference` :** A reference HapMap dataset file. This is required by the ANGSD tool to estimate nuclear X-chromosome contamination in human ancient DNA samples.\n\n\n## Workflow Steps\nBy default the pipeline currently performs the following:\n\n## 1. Preprocessing and Quality Control\n* **Format Conversion:** Converts input files from BAM/SAM format to FASTQ format (`Picard SamToFastq`)\n* **Quality Control:** Evaluates read quality before and after trimming (`FastQC`)\n* **Adapter Trimming:** Removes adapter sequences and merges paired-end reads (`AdapterRemoval`)\n\n## 2. Read Mapping and Processing\n* **Alignment:** Maps reads to the provided reference genome (`BWA`)\n* **Filtering and Statistics:** Separates unmapped reads and calculates alignment statistics (`Samtools View and Flagstat`)\n* **Duplicate Removal:** Detects and marks PCR duplicates (`Picard MarkDuplicates`)\n* **Alignment Quality:** Generates detailed BAM quality metrics (`QualiMap BamQC`)\n* **Library Complexity:** Estimates library complexity (`Preseq`)\n\n## 3. Ancient DNA (aDNA) Analysis\n* **Damage Profiling:** Visualizes aDNA-specific C-to-T damage patterns (`mapDamage`)\n* **Endogenous Content:** Calculates the proportion of endogenous (target) DNA in the sample (`EndorSpy`)\n* **Contamination:** Estimates nuclear X-chromosome contamination using HapMap data (`ANGSD X-Contamination`)\n\n## 4. Biological Information\n* **Sex Determination:** Determines biological sex based on relative chromosome coverage ratio (`Sex.DetERRmine`)\n* **Mt/Nuc Ratio:** Calculates the ratio of mitochondrial reads to nuclear reads (`MtNucRatioCalculator`)\n\n## 5. Genotyping\n* **Variant Analysis:** Performs variant calling to generate VCF files (`FreeBayes`)\n* **Variant Statistics:** Calculates statistics for the generated variants (`Bcftools stats`)\n\n## 6. Metagenomic Screening (For Unmapped Reads)\n* **Read Extraction:** Extracts unmapped reads for microbial analysis (`Picard SamToFastq`)\n* **Quality Filter:** Filters low-complexity sequences (`BBTools BBduk`)\n* **Taxonomic Classification:** Performs microbiome/taxonomic screening without alignment (`Kraken2`)\n\n## 7. Reporting\n* **Summary Report:** Aggregates logs and statistics from all these tools into a single interactive HTML report (`MultiQC`)\n\n\n## Workflow Outputs\nUpon successful execution, the workflow explicitly highlights and provides the following final files for analysis:\n\n* **`MultiQC Report` :** An interactive HTML report aggregating QC and analysis logs from all tools.\n* **`QualiMap BamQC Report` :** A detailed HTML report containing mapping quality metrics, GC content, and coverage statistics.\n* **`mapDamage Visualisation` :** Visual plots displaying the characteristic C-to-T deamination patterns at the ends of ancient DNA reads.\n* **`Kraken2 Report `:** A tabular report showing the taxonomic classification of unmapped reads.\n* **`EndorSpy Report `:** A JSON file containing the calculated endogenous DNA percentage.\n* **`Sex.DetERRmine Report` :** A JSON file containing relative chromosomal coverage and the calculated biological sex metrics.\n* **`Mt/Nuc Ratio Report` :** A JSON file containing the calculated ratio between mitochondrial and nuclear reads.\n* **`ANGSD Contamination Report` :** A tabular text file detailing the estimates of nuclear X-chromosome contamination.\n* **`Bcftools Stats Report` :** A text file containing comprehensive summary statistics for the called variants (VCF).\n\n\n## Testing Data\nTo ensure the workflow functions correctly, it was validated using the following datasets and databases:\n\n* **`Primary Test Data` :** The [JK2067](https://github.com/nf-core/test-datasets/blob/eager/testdata/Human/bam/JK2067.bam) BAM file (HiSeq 1240k captured UDG-half single-end libraries containing approximately 10,000 reads post-clipping) obtained from Lamnidis et al., 2018, Nat. Comms.\n* **`Primary Reference Genome` :** The [hs37d5_chr21-MT.fa.gz](https://github.com/nf-core/test-datasets/blob/eager/reference/Human/hs37d5_chr21-MT.fa.gz) file was utilized as the primary reference genome sequence.\n* **`X-Chromosome Contamination Reference` :** The [HapMap ChrX](https://github.com/ANGSD/angsd/blob/master/RES/HapMapChrX.gz) dataset was provided as the initial reference for the estimation of X-chromosome contamination using the ANGSD tool.\n* **`Taxonomic Classification Database` :** The Minikraken v2 database was utilized to perform taxonomic classification via Kraken2.", + "readme": "# Pipeline Summary\nThis workflow performs an ancient DNA (aDNA) based analysis similar to the one in the [nf-core/eager](https://nf-co.re/eager/2.5.3/) workflow. nf-core/eager is a bioinformatics best-practice processing pipeline for genomic NGS sequencing data, with a focus on ancient DNA data. It is ideal for the (palaeo)genomic analysis of humans, animals, plants, microbes and even microbiomes.\n\nThe pipeline processes the sequencing-read input provided to the workflow together with a reference genome and optional supporting reference data. It aligns reads and performs extensive general NGS and aDNA-specific quality control on the results.\n\n\n## Required & Optional Inputs\nTo run this workflow successfully, you need to provide the following input datasets and parameters:\n\n* **`Input reads` :** Input single-end FASTQ reads for the sample.\n* **`Reference genome` :** Reference genome sequence in FASTA format. This is essential for read mapping and variant calling.\n* **`Choose Mapper` :** Switch to select the alignment tool. Choose between BWA and Bowtie2.\n* **`Hap Map ChrX reference` :** HapMap dataset required for X-chromosome contamination estimation in ANGSD.\n* **`Input Mitochondrial Chromosome Name` :** The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS).\n* **`Kraken2 database directory` :** The database directory required for Kraken2 taxonomic classification.\n* **`Optional BED file for Sex.DetERRmine` :** An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms.\n* **`ANGSD region parameter` :** The specific genomic region to restrict the ANGSD analysis (typically 'X' for human male nuclear contamination estimation).\n\n\n## Workflow Steps\nBy default the pipeline currently performs the following:\n\n## 1. Preprocessing and Quality Control\n* **Quality Control:** Evaluates read quality before and after trimming (`FastQC`)\n* **Adapter Trimming:** Removes adapter sequences (`AdapterRemoval`)\n\n## 2. Read Mapping and Processing\n* **Alignment:** Maps reads to the provided reference genome conditionally using either (`BWA`) or (`Bowtie2`) based on user selection\n* **Filtering and Statistics:** Separates unmapped reads and calculates alignment statistics (`Samtools View and Flagstat`)\n* **Duplicate Removal:** Detects and marks PCR duplicates (`Picard MarkDuplicates`)\n* **Alignment Quality:** Generates detailed BAM quality metrics (`QualiMap BamQC`)\n* **Library Complexity:** Estimates library complexity (`Preseq`)\n\n## 3. Ancient DNA (aDNA) Analysis\n* **Damage Profiling:** Visualizes aDNA-specific C-to-T damage patterns (`mapDamage`)\n* **Endogenous Content:** Calculates the proportion of endogenous (target) DNA in the sample (`EndorSpy`)\n* **(`Optional`) Contamination:** Estimates nuclear X-chromosome contamination conditionally if HapMap data is provided (`ANGSD X-Contamination`)\n\n## 4. Biological Information\n* **Sex Determination:** Determines biological sex based on relative chromosome coverage ratio. This step adapts conditionally whether an optional BED file is provided (`Sex.DetERRmine`)\n* **Mt/Nuc Ratio:** Calculates the ratio of mitochondrial reads to nuclear reads utilizing the specified mitochondrial chromosome name (`MtNucRatioCalculator`)\n\n## 5. Genotyping\n* **Variant Analysis:** Performs variant calling to generate VCF files (`FreeBayes`)\n* **Variant Statistics:** Calculates statistics for the generated variants (`Bcftools stats`)\n\n## 6. Metagenomic Screening (For Unmapped Reads)\n* **Read Extraction:** Extracts unmapped reads for microbial analysis (`Picard SamToFastq`)\n* **Quality Filter:** Filters low-complexity sequences (`BBTools BBduk`)\n* **Taxonomic Classification:** Performs microbiome/taxonomic screening on the filtered unmapped reads (`Kraken2`)\n\n## 7. Reporting\n* **Summary Report:** Aggregates logs and statistics from all these tools into a single interactive HTML report (`MultiQC`)\n\n\n## Workflow Outputs\nUpon successful execution, the workflow explicitly provides the following final files for analysis:\n\n* **`MultiQC aggregated workflow summary report` :** An interactive HTML report aggregating QC and analysis logs from all tools.\n* **`QualiMap BamQC general alignment quality metrics report` :** A detailed HTML report containing mapping quality metrics, GC content, and coverage statistics.\n* **`mapDamage Visualisation` :** Visual plots displaying the characteristic C-to-T deamination patterns at the ends of ancient DNA reads.\n* **`Kraken2 taxonomic classification and microbial screening report` :** A tabular report showing the taxonomic classification of unmapped reads.\n* **`EndorSpy endogenous DNA authentication report` :** A JSON file containing the calculated endogenous DNA percentage.\n* **`Sex.DetERRmine (Without BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for human-genome alignments.\n* **`Sex.DetERRmine (With BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for targeted capture regions.\n* **`Mitochondrial to nuclear DNA ratio calculation report` :** A JSON file containing the calculated ratio between mitochondrial and nuclear reads.\n* **`ANGSD report of nuclear contamination estimation` :** A tabular text file detailing the estimates of nuclear X-chromosome contamination.\n* **`Bcftools variant calling summary statistics report` :** A text file containing comprehensive summary statistics for the called variants (VCF).\n* **`Fully post-processed mapping results` :** The final deduplicated and filtered alignment BAM file.\n* **`Freebayes raw genomic variant calls` :** The raw VCF file generated from variant analysis.\n\n\n## Testing Data\nTo ensure the workflow functions correctly, it was validated using the following datasets and databases:\n\n* **`Primary Test Data` :** A downsampled single-end FASTQ dataset (`NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz`) optimized for rapid workflow testing and validation.\n* **`Primary Reference Genome` :** The [hs37d5_chr21-MT.fa.gz](https://github.com/nf-core/test-datasets/blob/eager/reference/Human/hs37d5_chr21-MT.fa.gz) file was utilized as the primary reference genome sequence.\n* **`X-Chromosome Contamination Reference` :** The [HapMap ChrX](https://github.com/ANGSD/angsd/blob/master/RES/HapMapChrX.gz) dataset was provided as the initial reference for the estimation of X-chromosome contamination using the ANGSD tool.\n* **`Taxonomic Classification Database` :** The Minikraken v2 database was utilized to perform taxonomic classification via Kraken2.", "report": { "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" }, "steps": { "0": { - "annotation": "Input FASTQ reads (single-end or paired-end) for the sample.", + "annotation": "Input single-end FASTQ reads for the sample.", "content_id": null, "errors": null, "id": 0, "input_connections": {}, "inputs": [ { - "description": "Input FASTQ reads (single-end or paired-end) for the sample.", - "name": "InputReads" + "description": "Input single-end FASTQ reads for the sample.", + "name": "Input reads" } ], - "label": "InputReads", + "label": "Input reads", "name": "Input dataset", "outputs": [], "position": { - "left": 0, - "top": 0 + "left": 0.1056357854538455, + "top": 184.41450948321622 }, "tool_id": null, "tool_state": "{\"optional\": false, \"tag\": null}", @@ -46,124 +45,203 @@ "workflow_outputs": [] }, "1": { - "annotation": "Reference genome sequence in FASTA format.", + "annotation": "Switch to select the alignment tool.", "content_id": null, "errors": null, "id": 1, "input_connections": {}, "inputs": [ { - "description": "Reference genome sequence in FASTA format.", - "name": "ReferenceGenome" + "description": "Switch to select the alignment tool.", + "name": "Choose Mapper" } ], - "label": "ReferenceGenome", - "name": "Input dataset", + "label": "Choose Mapper", + "name": "Input parameter", "outputs": [], "position": { - "left": 600, - "top": 2180 + "left": 0, + "top": 988.1275633734917 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictions\": [\"BWA\", \"Bowtie2\"], \"parameter_type\": \"text\", \"optional\": false}", "tool_version": null, - "type": "data_input", - "uuid": "ce609edc-8e3a-4a48-8599-217da2720699", + "type": "parameter_input", + "uuid": "6fb6f861-a6bf-4cc7-9afd-0bbbcb8d6c6c", "when": null, "workflow_outputs": [] }, "2": { - "annotation": "HapMap dataset required for X-chromosome contamination estimation in ANGSD.", + "annotation": "An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms.", "content_id": null, "errors": null, "id": 2, "input_connections": {}, "inputs": [ { - "description": "HapMap dataset required for X-chromosome contamination estimation in ANGSD.", - "name": "HapMapChrXReference" + "description": "An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms.", + "name": "Optional BED file for Sex.DetERRmine" } ], - "label": "HapMapChrXReference", + "label": "Optional BED file for Sex.DetERRmine", "name": "Input dataset", "outputs": [], "position": { - "left": 2000, - "top": 1360 + "left": 1199.7684534476482, + "top": 173.01636542117905 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_state": "{\"optional\": true, \"tag\": null}", "tool_version": null, "type": "data_input", - "uuid": "065dc0b0-f3a8-40f7-b433-d9073fb0a4fd", + "uuid": "ab2309d8-46e7-4142-a5fa-f35008e090d8", "when": null, "workflow_outputs": [] }, "3": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_SamToFastq/3.1.1.0", + "annotation": "The specific genomic region to restrict the ANGSD analysis (typically 'X' for human male nuclear contamination estimation).", + "content_id": null, "errors": null, "id": 3, - "input_connections": { - "inputFile": { - "id": 0, - "output_name": "output" + "input_connections": {}, + "inputs": [ + { + "description": "The specific genomic region to restrict the ANGSD analysis (typically 'X' for human male nuclear contamination estimation).", + "name": "ANGSD region parameter" } + ], + "label": "ANGSD region parameter", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 1601.387335993921, + "top": 798.3690333992074 }, - "inputs": [], - "label": null, - "name": "SamToFastq", - "outputs": [ - { - "name": "fq_single", - "type": "fastqsanger" - }, - { - "name": "interleaved_fastq", - "type": "fastqsanger" - }, + "tool_id": null, + "tool_state": "{\"default\": \"X:5000000-154900000\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "74a40872-f977-4ebb-8eb0-7bfa6508ca74", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS).", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ { - "name": "fq1", - "type": "fastqsanger" - }, + "description": "The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS).", + "name": "Input Mitochondrial Chromosome Name" + } + ], + "label": "Input Mitochondrial Chromosome Name", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 1602.3933158974728, + "top": 1376.8717022918875 + }, + "tool_id": null, + "tool_state": "{\"default\": \"MT\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "3dda9710-d18b-4622-90d9-4bfba0cda536", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "Reference genome sequence in FASTA format.", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ { - "name": "fq2", - "type": "fastqsanger" - }, + "description": "Reference genome sequence in FASTA format.", + "name": "Reference genome" + } + ], + "label": "Reference genome", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 0.4480965455411092, + "top": 2372.3275602030662 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "ce609edc-8e3a-4a48-8599-217da2720699", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "HapMap dataset required for X-chromosome contamination estimation in ANGSD.", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, + "inputs": [ { - "name": "fq_u", - "type": "fastqsanger" + "description": "HapMap dataset required for X-chromosome contamination estimation in ANGSD.", + "name": "Hap Map ChrX reference" } ], + "label": "Hap Map ChrX reference", + "name": "Input dataset", + "outputs": [], "position": { - "left": 300, - "top": 0 + "left": 2000.089914983151, + "top": 1659.5278606377417 }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_SamToFastq/3.1.1.0", - "tool_shed_repository": { - "changeset_revision": "3f254c5ced1d", - "name": "picard", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" + "tool_id": null, + "tool_state": "{\"optional\": true, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "065dc0b0-f3a8-40f7-b433-d9073fb0a4fd", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "", + "content_id": null, + "errors": null, + "id": 7, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Kraken2 database directory" + } + ], + "label": "Kraken2 database directory", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 2000.8949373652963, + "top": 1870.952666103986 }, - "tool_state": "{\"clipping_action\": \"\", \"clipping_attribute\": \"\", \"include_non_pf_reads\": true, \"include_non_primary_alignments\": true, \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"re_reverse\": true, \"read1_max_bases_to_write\": \"-1\", \"read1_trim\": \"0\", \"read2_max_bases_to_write\": \"-1\", \"read2_trim\": \"0\", \"single_or_paired\": \"se\", \"validation_stringency\": \"LENIENT\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "3.1.1.0", - "type": "tool", - "uuid": "c7a2e6ff-2b80-484e-b83a-52d0769d6a0a", + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "ed8e4694-68ad-4d93-a475-42ba9a9eb7ed", "when": null, "workflow_outputs": [] }, - "4": { + "8": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", "errors": null, - "id": 4, + "id": 8, "input_connections": { "input_file": { - "id": 3, - "output_name": "fq_single" + "id": 0, + "output_name": "output" } }, "inputs": [ @@ -193,8 +271,8 @@ } ], "position": { - "left": 600, - "top": 0 + "left": 350.29213341262863, + "top": 167.11620392894682 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", @@ -212,15 +290,15 @@ "when": null, "workflow_outputs": [] }, - "5": { + "9": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", "errors": null, - "id": 5, + "id": 9, "input_connections": { "input_type_cond|read1": { - "id": 3, - "output_name": "fq_single" + "id": 0, + "output_name": "output" } }, "inputs": [ @@ -246,8 +324,8 @@ } ], "position": { - "left": 600, - "top": 330 + "left": 350.29213341262863, + "top": 497.11620392894685 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", @@ -265,14 +343,239 @@ "when": null, "workflow_outputs": [] }, - "6": { + "10": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 10, + "input_connections": { + "input_param_type|input_param": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": "Map BWA Selected", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 350.65453516320207, + "top": 907.1825011282847 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"BWA\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "f39564d9-9c1a-459a-bcce-27958b2d8030", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 11, + "input_connections": { + "input_param_type|input_param": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": "Map Bowtie2 Selected", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 350.1073815457526, + "top": 1066.8526379615103 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"Bowtie2\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "7e68999f-4e2a-439c-baec-3d4c96cbf3cd", + "when": null, + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 12, + "input_connections": { + "input_param_type|input_param": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": "Map BED Absent", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1600.150017502409, + "top": 32.677624278774545 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"null\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "719ca7c9-40f9-4824-a964-d30c769ca649", + "when": null, + "workflow_outputs": [] + }, + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 13, + "input_connections": { + "input_param_type|input_param": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": "Map BED Present", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1599.9667721541668, + "top": 253.4701270710153 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"null\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "2e3b19f9-9761-432d-8aa3-729384d4965d", + "when": null, + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 14, + "input_connections": { + "input_param_type|input_param": { + "id": 6, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": "Map Hap Map reference Present", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 1998.083739285998, + "top": 1365.207073078407 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"null\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": null, \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "aace4dd5-12b7-4dab-a9a4-ff08b1408f44", + "when": null, + "workflow_outputs": [] + }, + "15": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", "errors": null, - "id": 6, + "id": 15, "input_connections": { "input_file": { - "id": 5, + "id": 9, "output_name": "output_truncated" } }, @@ -303,8 +606,8 @@ } ], "position": { - "left": 950, - "top": 350 + "left": 950.1056357854538, + "top": 534.4145094832163 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", @@ -322,19 +625,23 @@ "when": null, "workflow_outputs": [] }, - "7": { + "16": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa/0.7.19", "errors": null, - "id": 7, + "id": 16, "input_connections": { "input_type|fastq_input1": { - "id": 5, + "id": 9, "output_name": "output_truncated" }, "reference_source|ref_file": { - "id": 1, + "id": 5, "output_name": "output" + }, + "when": { + "id": 10, + "output_name": "output_param_boolean" } }, "inputs": [ @@ -356,8 +663,8 @@ } ], "position": { - "left": 950, - "top": 680 + "left": 702.0470939670415, + "top": 873.6346839710825 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa/0.7.19", @@ -372,18 +679,119 @@ "tool_version": "0.7.19", "type": "tool", "uuid": "d099da6f-ba0d-472d-a27e-4b121b232b8a", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "17": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.5+galaxy0", + "errors": null, + "id": 17, + "input_connections": { + "library|input_1": { + "id": 9, + "output_name": "output_truncated" + }, + "reference_genome|own_file": { + "id": 5, + "output_name": "output" + }, + "when": { + "id": 11, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Bowtie2", + "name": "library" + }, + { + "description": "runtime parameter for tool Bowtie2", + "name": "reference_genome" + } + ], + "label": null, + "name": "Bowtie2", + "outputs": [ + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 703.0273000312051, + "top": 1099.0275359513378 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.5+galaxy0", + "tool_shed_repository": { + "changeset_revision": "a470b376503d", + "name": "bowtie2", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 1, \"input_options\": {\"input_options_selector\": \"no\", \"__current_case__\": 1}, \"alignment_options\": {\"alignment_options_selector\": \"no\", \"__current_case__\": 1}, \"scoring_options\": {\"scoring_options_selector\": \"no\", \"__current_case__\": 1}, \"reporting_options\": {\"reporting_options_selector\": \"no\", \"__current_case__\": 0}, \"effort_options\": {\"effort_options_selector\": \"no\", \"__current_case__\": 1}, \"other_options\": {\"other_options_selector\": \"no\", \"__current_case__\": 1}}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false}, \"reference_genome\": {\"source\": \"history\", \"__current_case__\": 1, \"own_file\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"set\", \"__current_case__\": 1, \"read_group_id_conditional\": {\"do_auto_name\": \"yes\", \"__current_case__\": 0}, \"read_group_sm_conditional\": {\"do_auto_name\": \"yes\", \"__current_case__\": 0}, \"PL\": \"ILLUMINA\", \"read_group_lb_conditional\": {\"do_auto_name\": \"yes\", \"__current_case__\": 0}, \"CN\": null, \"DS\": null, \"DT\": null, \"FO\": null, \"KS\": null, \"PG\": null, \"PI\": null, \"PU\": null}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.5.5+galaxy0", + "type": "tool", + "uuid": "fbdf32b8-2d12-437f-a3a6-52666a58b724", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "18": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 18, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 16, + "output_name": "bam_output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 17, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 947.7733887896687, + "top": 948.3909231499435 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "39513036-91a0-4ff5-81c6-39c9172711e6", "when": null, "workflow_outputs": [] }, - "8": { + "19": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/preseq_c_curve/preseq_c_curve/3.2.0+galaxy0", "errors": null, - "id": 8, + "id": 19, "input_connections": { "input_bam": { - "id": 7, - "output_name": "bam_output" + "id": 18, + "output_name": "data_param" } }, "inputs": [], @@ -396,8 +804,8 @@ } ], "position": { - "left": 1250, - "top": 530 + "left": 1250.1056357854538, + "top": 714.4145094832163 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/preseq_c_curve/preseq_c_curve/3.2.0+galaxy0", @@ -415,15 +823,15 @@ "when": null, "workflow_outputs": [] }, - "9": { + "20": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", "errors": null, - "id": 9, + "id": 20, "input_connections": { "input1": { - "id": 7, - "output_name": "bam_output" + "id": 18, + "output_name": "data_param" } }, "inputs": [], @@ -436,8 +844,8 @@ } ], "position": { - "left": 1250, - "top": 680 + "left": 1250.1056357854538, + "top": 864.4145094832163 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", @@ -455,15 +863,15 @@ "when": null, "workflow_outputs": [] }, - "10": { + "21": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.22+galaxy1", "errors": null, - "id": 10, + "id": 21, "input_connections": { "input": { - "id": 7, - "output_name": "bam_output" + "id": 18, + "output_name": "data_param" } }, "inputs": [], @@ -480,8 +888,8 @@ } ], "position": { - "left": 1250, - "top": 940 + "left": 1250.1056357854538, + "top": 1124.4145094832163 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.22+galaxy1", @@ -499,14 +907,14 @@ "when": null, "workflow_outputs": [] }, - "11": { + "22": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", "errors": null, - "id": 11, + "id": 22, "input_connections": { "input1": { - "id": 10, + "id": 21, "output_name": "outputsam" } }, @@ -520,8 +928,8 @@ } ], "position": { - "left": 1600, - "top": 730 + "left": 1600.1056357854538, + "top": 914.4145094832163 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", @@ -539,14 +947,14 @@ "when": null, "workflow_outputs": [] }, - "12": { + "23": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", "errors": null, - "id": 12, + "id": 23, "input_connections": { "inputFile": { - "id": 10, + "id": 21, "output_name": "outputsam" } }, @@ -564,8 +972,8 @@ } ], "position": { - "left": 1600, - "top": 940 + "left": 1600.105625861612, + "top": 1124.4145641851394 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", @@ -581,16 +989,22 @@ "type": "tool", "uuid": "8c03718a-0bad-48be-80de-138664f66696", "when": null, - "workflow_outputs": [] + "workflow_outputs": [ + { + "label": "Fully post-processed mapping results", + "output_name": "outFile", + "uuid": "626f2554-3811-4706-b852-45621d96564a" + } + ] }, - "13": { + "24": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_SamToFastq/3.1.1.0", "errors": null, - "id": 13, + "id": 24, "input_connections": { "inputFile": { - "id": 10, + "id": 21, "output_name": "invoutputsam" } }, @@ -620,8 +1034,8 @@ } ], "position": { - "left": 1600, - "top": 1500 + "left": 1600.1056357854538, + "top": 1684.4145094832163 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_SamToFastq/3.1.1.0", @@ -639,18 +1053,18 @@ "when": null, "workflow_outputs": [] }, - "14": { + "25": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/endorspy/endorspy/1.3+galaxy0", "errors": null, - "id": 14, + "id": 25, "input_connections": { "post_flagstat": { - "id": 11, + "id": 22, "output_name": "output1" }, "pre_flagstat": { - "id": 9, + "id": 20, "output_name": "output1" } }, @@ -669,8 +1083,8 @@ } ], "position": { - "left": 2000, - "top": 370 + "left": 2002.5248625893973, + "top": 659.2716922696325 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/endorspy/endorspy/1.3+galaxy0", @@ -688,70 +1102,92 @@ "when": null, "workflow_outputs": [ { - "label": "EndorSpyReport", + "label": "EndorSpy endogenous DNA authentication report", "output_name": "output_json", - "uuid": "d95c7110-e27a-4c77-904e-15e88ad8c702" + "uuid": "598c742f-9eb5-4661-8caf-248cc51f6561" } ] }, - "15": { + "26": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd/0.940+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", "errors": null, - "id": 15, + "id": 26, "input_connections": { - "input_bams": { - "id": 12, + "input_bam": { + "id": 23, "output_name": "outFile" + }, + "when": { + "id": 12, + "output_name": "output_param_boolean" } }, - "inputs": [], - "label": null, - "name": "ANGSD", + "inputs": [ + { + "description": "runtime parameter for tool Sex.DetERRmine", + "name": "input_bed" + } + ], + "label": "Sex.DetERRmine (Without BED)", + "name": "Sex.DetERRmine", "outputs": [ { - "name": "output_icnts", - "type": "gz" + "name": "output_report", + "type": "tabular" + }, + { + "name": "output_json", + "type": "json" } ], "position": { - "left": 2000, - "top": 580 + "left": 2001.600044364478, + "top": 0.0 }, "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd/0.940+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", "tool_shed_repository": { - "changeset_revision": "7b0e59047b2f", - "name": "angsd", + "changeset_revision": "cf3d9775d7ae", + "name": "sexdeterrmine", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_bams\": {\"__class__\": \"ConnectedValue\"}, \"min_mapq\": \"30\", \"min_q\": \"30\", \"region\": \"X:5000000-154900000\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"base_quality\": \"30\", \"generate_json\": true, \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"input_bed\": {\"__class__\": \"RuntimeValue\"}, \"map_quality\": \"30\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.940+galaxy0", + "tool_version": "1.1.2+galaxy1", "type": "tool", - "uuid": "14301510-0957-4dd6-a410-9f3495de2bda", - "when": null, - "workflow_outputs": [] + "uuid": "4e668417-4ec2-4c9e-a980-7ac9798221b1", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "Sex.DetERRmine (Without BED) report of chromosomal gender estimation", + "output_name": "output_json", + "uuid": "6721fbbc-cd33-48cf-861e-8c46e92cfdf5" + } + ] }, - "16": { + "27": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", "errors": null, - "id": 16, + "id": 27, "input_connections": { "input_bam": { - "id": 12, + "id": 23, "output_name": "outFile" + }, + "input_bed": { + "id": 2, + "output_name": "output" + }, + "when": { + "id": 13, + "output_name": "output_param_boolean" } }, - "inputs": [ - { - "description": "runtime parameter for tool Sex.DetERRmine", - "name": "input_bed" - } - ], - "label": null, + "inputs": [], + "label": "Sex.DetERRmine (With BED)", "name": "Sex.DetERRmine", "outputs": [ { @@ -764,8 +1200,8 @@ } ], "position": { - "left": 2000, - "top": 730 + "left": 2000.0499611910461, + "top": 334.0709520237296 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", @@ -775,29 +1211,83 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"base_quality\": \"30\", \"generate_json\": true, \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"input_bed\": {\"__class__\": \"RuntimeValue\"}, \"map_quality\": \"30\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"base_quality\": \"30\", \"generate_json\": true, \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"input_bed\": {\"__class__\": \"ConnectedValue\"}, \"map_quality\": \"30\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "1.1.2+galaxy1", "type": "tool", - "uuid": "4e668417-4ec2-4c9e-a980-7ac9798221b1", - "when": null, + "uuid": "82db9a82-ed78-43bf-92ca-a94580f2da2f", + "when": "$(inputs.when)", "workflow_outputs": [ { - "label": "SexdetERRmineReport", + "label": "Sex.DetERRmine (With BED) report of chromosomal gender estimation", "output_name": "output_json", - "uuid": "bcf1b833-8878-4610-be21-42045cdb1684" + "uuid": "d13c0eaa-3c2a-42b5-bb64-b449e1409baa" } ] }, - "17": { + "28": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.3+galaxy0", + "errors": null, + "id": 28, + "input_connections": { + "input1": { + "id": 23, + "output_name": "outFile" + } + }, + "inputs": [], + "label": null, + "name": "QualiMap BamQC", + "outputs": [ + { + "name": "raw_data", + "type": "input" + }, + { + "name": "output_html", + "type": "html" + } + ], + "position": { + "left": 2001.1320029417996, + "top": 888.0165040989987 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "30a201c9c310", + "name": "qualimap_bamqc", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"duplicate_skipping\": null, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"per_base_coverage\": false, \"plot_specific\": {\"n_bins\": \"400\", \"paint_chromosome_limits\": true, \"genome_gc_distr\": null, \"homopolymer_size\": \"3\"}, \"stats_regions\": {\"region_select\": \"all\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "df529c99-8475-4abe-b08d-6381fa1c7506", + "when": null, + "workflow_outputs": [ + { + "label": "QualiMap BamQC general alignment quality metrics report", + "output_name": "output_html", + "uuid": "47c590cf-b109-4d1a-97b5-341427fe9dff" + } + ] + }, + "29": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/mtnucratio/mtnucratio/0.7.1+galaxy0", "errors": null, - "id": 17, + "id": 29, "input_connections": { "input_bam": { - "id": 12, + "id": 23, "output_name": "outFile" + }, + "mt_chrom_name": { + "id": 4, + "output_name": "output" } }, "inputs": [], @@ -814,8 +1304,8 @@ } ], "position": { - "left": 2000, - "top": 960 + "left": 2000.0999244419543, + "top": 1101.2232848477568 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/mtnucratio/mtnucratio/0.7.1+galaxy0", @@ -825,7 +1315,7 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"mt_chrom_name\": \"MT\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"mt_chrom_name\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "0.7.1+galaxy0", "type": "tool", @@ -833,74 +1323,72 @@ "when": null, "workflow_outputs": [ { - "label": "MtNucReport", + "label": "Mitochondrial to nuclear DNA ratio calculation report", "output_name": "output_json", - "uuid": "203d3d8a-85e4-4ad9-aa34-b8c5c08da9d6" + "uuid": "0d40de9d-382d-4071-a597-451d63c84b76" } ] }, - "18": { + "30": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.3+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd/0.940+galaxy0", "errors": null, - "id": 18, + "id": 30, "input_connections": { - "input1": { - "id": 12, + "input_bams": { + "id": 23, "output_name": "outFile" + }, + "region": { + "id": 3, + "output_name": "output" + }, + "when": { + "id": 14, + "output_name": "output_param_boolean" } }, "inputs": [], "label": null, - "name": "QualiMap BamQC", + "name": "ANGSD", "outputs": [ { - "name": "raw_data", - "type": "input" - }, - { - "name": "output_html", - "type": "html" + "name": "output_icnts", + "type": "gz" } ], "position": { - "left": 2000, - "top": 1160 + "left": 1999.262376063348, + "top": 1502.4949580714795 }, "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.3+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd/0.940+galaxy0", "tool_shed_repository": { - "changeset_revision": "30a201c9c310", - "name": "qualimap_bamqc", + "changeset_revision": "7b0e59047b2f", + "name": "angsd", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"duplicate_skipping\": null, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"per_base_coverage\": false, \"plot_specific\": {\"n_bins\": \"400\", \"paint_chromosome_limits\": true, \"genome_gc_distr\": null, \"homopolymer_size\": \"3\"}, \"stats_regions\": {\"region_select\": \"all\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_bams\": {\"__class__\": \"ConnectedValue\"}, \"min_mapq\": \"30\", \"min_q\": \"30\", \"region\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "2.3+galaxy0", + "tool_version": "0.940+galaxy0", "type": "tool", - "uuid": "df529c99-8475-4abe-b08d-6381fa1c7506", - "when": null, - "workflow_outputs": [ - { - "label": "BamQCReport", - "output_name": "output_html", - "uuid": "176b3596-a676-4776-96d1-f96bcbb55ba1" - } - ] + "uuid": "14301510-0957-4dd6-a410-9f3495de2bda", + "when": "$(inputs.when)", + "workflow_outputs": [] }, - "19": { + "31": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_damage/map_damage/2.2.3+galaxy0", "errors": null, - "id": 19, + "id": 31, "input_connections": { "reference|history_reference": { - "id": 1, + "id": 5, "output_name": "output" }, "sbam_file": { - "id": 12, + "id": 23, "output_name": "outFile" } }, @@ -923,8 +1411,8 @@ } ], "position": { - "left": 2000, - "top": 1670 + "left": 2000.799910004207, + "top": 1961.2829113704156 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_damage/map_damage/2.2.3+galaxy0", @@ -942,24 +1430,24 @@ "when": null, "workflow_outputs": [ { - "label": "DamageVisualisation", + "label": "mapDamage Visualisation", "output_name": "damage_visualisation", - "uuid": "1e565382-1ccc-49ac-951a-91a3bfbe86bf" + "uuid": "0abc7c16-1590-40ea-802e-2a599f865ba6" } ] }, - "20": { + "32": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/freebayes/freebayes/1.3.10+galaxy1", "errors": null, - "id": 20, + "id": 32, "input_connections": { "reference_source|batchmode|input_bams": { - "id": 12, + "id": 23, "output_name": "outFile" }, "reference_source|ref_file": { - "id": 1, + "id": 5, "output_name": "output" } }, @@ -978,8 +1466,8 @@ } ], "position": { - "left": 2000.1295929540572, - "top": 2013.447603782008 + "left": 2000.2250735220819, + "top": 2247.9675767022045 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/freebayes/freebayes/1.3.10+galaxy1", @@ -989,22 +1477,28 @@ "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"coverage_options\": {\"coverage_options_selector\": \"set\", \"__current_case__\": 0, \"min_coverage\": \"0\", \"limit_coverage\": \"0\", \"skip_coverage\": \"0\"}, \"options_type\": {\"options_type_selector\": \"full\", \"__current_case__\": 0, \"optional_inputs\": {\"optional_inputs_selector\": \"do_not_set\", \"__current_case__\": 1}, \"reporting\": {\"reporting_selector\": \"do_not_set\", \"__current_case__\": 1}, \"population_model\": {\"population_model_selector\": \"set\", \"__current_case__\": 0, \"T\": \"0.01\", \"P\": \"2\", \"J\": false, \"K\": false}, \"reference_allele\": {\"reference_allele_selector\": \"do_not_set\", \"__current_case__\": 1}, \"allele_scope\": {\"allele_scope_selector\": \"do_not_set\", \"__current_case__\": 1}, \"O\": false, \"input_filters\": {\"input_filters_selector\": \"set\", \"__current_case__\": 0, \"standard_filters\": false, \"use_duplicate_reads\": false, \"min_mapping_quality\": \"1\", \"min_base_quality\": \"0\", \"min_supporting_allele_qsum\": \"0\", \"min_supporting_mapping_qsum\": \"0\", \"mismatch_filters\": {\"mismatch_filters_selector\": \"do_not_set\", \"__current_case__\": 1}, \"read_indel_limit\": \"1000\", \"min_alternate_fraction\": \"0.05\", \"min_alternate_qsum\": \"0\", \"min_alternate_count\": \"1\", \"min_alternate_total\": \"1\"}, \"population_mappability_priors\": {\"population_mappability_priors_selector\": \"do_not_set\", \"__current_case__\": 1}, \"genotype_likelihoods\": {\"genotype_likelihoods_selector\": \"do_not_set\", \"__current_case__\": 1}, \"algorithmic_features\": {\"algorithmic_features_selector\": \"do_not_set\", \"__current_case__\": 1}}, \"output_options\": {\"flavor\": \"vcf\", \"__current_case__\": 0}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"batchmode\": {\"processmode\": \"individual\", \"__current_case__\": 0, \"input_bams\": {\"__class__\": \"RuntimeValue\"}}, \"ref_file\": {\"__class__\": \"RuntimeValue\"}}, \"target_limit_type\": {\"target_limit_type_selector\": \"do_not_limit\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"coverage_options\": {\"coverage_options_selector\": \"set\", \"__current_case__\": 0, \"min_coverage\": \"0\", \"limit_coverage\": \"0\", \"skip_coverage\": \"0\"}, \"options_type\": {\"options_type_selector\": \"full\", \"__current_case__\": 0, \"optional_inputs\": {\"optional_inputs_selector\": \"do_not_set\", \"__current_case__\": 1}, \"reporting\": {\"reporting_selector\": \"do_not_set\", \"__current_case__\": 1}, \"population_model\": {\"population_model_selector\": \"set\", \"__current_case__\": 0, \"T\": \"0.01\", \"P\": \"2\", \"J\": false, \"K\": false}, \"reference_allele\": {\"reference_allele_selector\": \"do_not_set\", \"__current_case__\": 1}, \"allele_scope\": {\"allele_scope_selector\": \"do_not_set\", \"__current_case__\": 1}, \"O\": false, \"input_filters\": {\"input_filters_selector\": \"set\", \"__current_case__\": 0, \"standard_filters\": false, \"use_duplicate_reads\": false, \"min_mapping_quality\": \"1\", \"min_base_quality\": \"0\", \"min_supporting_allele_qsum\": \"0\", \"min_supporting_mapping_qsum\": \"0\", \"mismatch_filters\": {\"mismatch_filters_selector\": \"do_not_set\", \"__current_case__\": 1}, \"read_indel_limit\": \"1000\", \"min_alternate_fraction\": \"0.05\", \"min_alternate_qsum\": \"0\", \"min_alternate_count\": \"1\", \"min_alternate_total\": \"1\"}, \"population_mappability_priors\": {\"population_mappability_priors_selector\": \"do_not_set\", \"__current_case__\": 1}, \"genotype_likelihoods\": {\"genotype_likelihoods_selector\": \"do_not_set\", \"__current_case__\": 1}, \"algorithmic_features\": {\"algorithmic_features_selector\": \"do_not_set\", \"__current_case__\": 1}}, \"output_options\": {\"flavor\": \"vcf\", \"__current_case__\": 0}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"batchmode\": {\"processmode\": \"individual\", \"__current_case__\": 0, \"input_bams\": {\"__class__\": \"ConnectedValue\"}}, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"target_limit_type\": {\"target_limit_type_selector\": \"do_not_limit\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "1.3.10+galaxy1", "type": "tool", "uuid": "2d59df66-a044-46f7-baa7-7da73293a238", "when": null, - "workflow_outputs": [] + "workflow_outputs": [ + { + "label": "Freebayes raw genomic variant calls", + "output_name": "output_vcf", + "uuid": "947ea898-b15a-4942-8caa-ae6efeb59c66" + } + ] }, - "21": { + "33": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bbtools_bbduk/bbtools_bbduk/39.08+galaxy4", "errors": null, - "id": 21, + "id": 33, "input_connections": { "input_type_cond|read1": { - "id": 13, + "id": 24, "output_name": "fq_single" } }, @@ -1023,8 +1517,8 @@ } ], "position": { - "left": 2000, - "top": 1500 + "left": 2000.0999862818837, + "top": 1748.9171112950867 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bbtools_bbduk/bbtools_bbduk/39.08+galaxy4", @@ -1042,19 +1536,67 @@ "when": null, "workflow_outputs": [] }, - "22": { + "34": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 34, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 26, + "output_name": "output_json" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 27, + "output_name": "output_json" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2412.6501900376466, + "top": 302.25264495281465 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "bbccad7f-b03c-4a3b-b2a4-5f2859f3b770", + "when": null, + "workflow_outputs": [] + }, + "35": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd_contamination/0.940+galaxy0", "errors": null, - "id": 22, + "id": 35, "input_connections": { "hapmap_file": { - "id": 2, + "id": 6, "output_name": "output" }, "icnts_file": { - "id": 15, + "id": 30, "output_name": "output_icnts" + }, + "when": { + "id": 14, + "output_name": "output_param_boolean" } }, "inputs": [], @@ -1067,8 +1609,8 @@ } ], "position": { - "left": 2300, - "top": 1280 + "left": 2298.7992105919184, + "top": 1464.4145655492782 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd_contamination/0.940+galaxy0", @@ -1083,27 +1625,27 @@ "tool_version": "0.940+galaxy0", "type": "tool", "uuid": "f47efc7e-ac0c-48fa-91f2-70fa86a26230", - "when": null, + "when": "$(inputs.when)", "workflow_outputs": [ { - "label": "ANGSDReport", + "label": "ANGSD report of nuclear contamination estimation", "output_name": "output_txt", - "uuid": "9e836184-d45a-450f-a377-f7d00c5b1364" + "uuid": "9346e028-6b32-4ed7-abaf-a2d6b2ea577c" } ] }, - "23": { + "36": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_stats/bcftools_stats/1.22+galaxy0", "errors": null, - "id": 23, + "id": 36, "input_connections": { "input_file": { - "id": 20, + "id": 32, "output_name": "output_vcf" }, "sec_default|reference_source|fasta_ref": { - "id": 1, + "id": 5, "output_name": "output" } }, @@ -1130,8 +1672,8 @@ } ], "position": { - "left": 2300, - "top": 2120 + "left": 2300.105635785454, + "top": 2304.414509483216 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_stats/bcftools_stats/1.22+galaxy0", @@ -1149,20 +1691,24 @@ "when": null, "workflow_outputs": [ { - "label": "bcftoolsReport", + "label": "Bcftools variant calling summary statistics report", "output_name": "output_file", - "uuid": "c2bb495b-0257-4d57-8920-725a1a14628f" + "uuid": "1d7f735a-c7b8-4db9-804b-9d0920684a5c" } ] }, - "24": { + "37": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/kraken2/kraken2/2.17.1+galaxy0", "errors": null, - "id": 24, + "id": 37, "input_connections": { + "kraken2_database": { + "id": 7, + "output_name": "output" + }, "single_paired|input_sequences": { - "id": 21, + "id": 33, "output_name": "outputu" } }, @@ -1185,8 +1731,8 @@ } ], "position": { - "left": 2300.000115313445, - "top": 1498.4843461922294 + "left": 2301.0873331369503, + "top": 1780.1526204372663 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/kraken2/kraken2/2.17.1+galaxy0", @@ -1196,7 +1742,7 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"confidence\": \"0.0\", \"kraken2_database\": \"2026-02-13T204037Z_minikraken2_v2_8GB\", \"min_base_quality\": \"0\", \"minimum_hit_groups\": \"2\", \"quick\": false, \"report\": {\"create_report\": \"true\", \"__current_case__\": 0, \"use_mpa_style\": false, \"report_zero_counts\": false, \"report_minimizer_data\": true}, \"single_paired\": {\"single_paired_selector\": \"no\", \"__current_case__\": 1, \"input_sequences\": {\"__class__\": \"ConnectedValue\"}}, \"split_reads\": false, \"use_names\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"confidence\": \"0.0\", \"kraken2_database\": {\"__class__\": \"ConnectedValue\"}, \"min_base_quality\": \"0\", \"minimum_hit_groups\": \"2\", \"quick\": false, \"report\": {\"create_report\": \"true\", \"__current_case__\": 0, \"use_mpa_style\": false, \"report_zero_counts\": false, \"report_minimizer_data\": true}, \"single_paired\": {\"single_paired_selector\": \"no\", \"__current_case__\": 1, \"input_sequences\": {\"__class__\": \"ConnectedValue\"}}, \"split_reads\": false, \"use_names\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "2.17.1+galaxy0", "type": "tool", @@ -1204,64 +1750,64 @@ "when": null, "workflow_outputs": [ { - "label": "Kraken2Report", + "label": "Kraken2 taxonomic classification and microbial screening report", "output_name": "report_output", - "uuid": "fde3b893-28ea-4608-a36d-1b1ea38bc026" + "uuid": "46c3c191-2f90-46fa-bf32-6f3a696a8a66" } ] }, - "25": { + "38": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.34+galaxy0", "errors": null, - "id": 25, + "id": 38, "input_connections": { "results_0|software_cond|output_0|input": { - "id": 4, + "id": 8, "output_name": "text_file" }, "results_10|software_cond|input": { - "id": 19, + "id": 31, "output_name": "damage_visualisation" }, "results_11|software_cond|input": { - "id": 23, + "id": 36, "output_name": "output_file" }, "results_1|software_cond|input": { - "id": 5, + "id": 9, "output_name": "output_settings" }, "results_2|software_cond|output_0|input": { - "id": 6, + "id": 15, "output_name": "text_file" }, "results_3|software_cond|input": { - "id": 8, + "id": 19, "output_name": "output_tsv" }, "results_4|software_cond|output_0|type|input": { - "id": 9, + "id": 20, "output_name": "output1" }, "results_5|software_cond|output_0|type|input": { - "id": 11, + "id": 22, "output_name": "output1" }, "results_6|software_cond|output_0|input": { - "id": 12, + "id": 23, "output_name": "metrics_file" }, "results_7|software_cond|input": { - "id": 16, - "output_name": "output_json" + "id": 34, + "output_name": "data_param" }, "results_8|software_cond|input": { - "id": 18, + "id": 28, "output_name": "raw_data" }, "results_9|software_cond|input": { - "id": 24, + "id": 37, "output_name": "report_output" } }, @@ -1284,8 +1830,8 @@ } ], "position": { - "left": 2925.562544551844, - "top": 288.17191621094787 + "left": 2925.668180337298, + "top": 472.5864256941641 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.34+galaxy0", @@ -1303,14 +1849,14 @@ "when": null, "workflow_outputs": [ { - "label": "MultiQCReport", + "label": "MultiQC aggregated workflow summary report", "output_name": "html_report", - "uuid": "427a3f87-3626-493f-b137-ba257a1e6ea0" + "uuid": "30712e44-8e0c-441a-9990-cf51195542a4" } ] } }, "tags": [], - "uuid": "21f27328-944e-42ff-9019-598922fc5a04", - "version": 64 + "uuid": "e45fbf34-717f-4429-847e-c704938d89c9", + "version": 145 } \ No newline at end of file From 2529c723527fc068f3cf87931451ef44811e96e1 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Mert=20Ayd=C4=B1n?= <56894545+mertydn@users.noreply.github.com> Date: Mon, 18 May 2026 18:22:40 +0200 Subject: [PATCH 03/17] Update Kraken2 database directory in workflow --- workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml index b1fc427d2d..7b17fdd055 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml +++ b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml @@ -14,7 +14,7 @@ filetype: gz Choose Mapper: BWA Optional BED file for Sex.DetERRmine: null - Kraken2 database directory: 2026-02-13T204037Z_minikraken2_v2_8GB + Kraken2 database directory: k2_standard_20210517 outputs: Fully post-processed mapping results: asserts: From ef57447534d238c965df6c04860a6b9727b20cbb Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Mert=20Ayd=C4=B1n?= <56894545+mertydn@users.noreply.github.com> Date: Mon, 18 May 2026 18:29:44 +0200 Subject: [PATCH 04/17] Add release version to adna-analysis.ga --- workflows/paleogenomics/adna-analysis/adna-analysis.ga | 3 ++- 1 file changed, 2 insertions(+), 1 deletion(-) diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis.ga b/workflows/paleogenomics/adna-analysis/adna-analysis.ga index dc1b5ecb31..5a652cece4 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis.ga +++ b/workflows/paleogenomics/adna-analysis/adna-analysis.ga @@ -11,6 +11,7 @@ ], "format-version": "0.1", "license": "MIT", + "release": "0.1", "name": "Ancient DNA analysis", "readme": "# Pipeline Summary\nThis workflow performs an ancient DNA (aDNA) based analysis similar to the one in the [nf-core/eager](https://nf-co.re/eager/2.5.3/) workflow. nf-core/eager is a bioinformatics best-practice processing pipeline for genomic NGS sequencing data, with a focus on ancient DNA data. It is ideal for the (palaeo)genomic analysis of humans, animals, plants, microbes and even microbiomes.\n\nThe pipeline processes the sequencing-read input provided to the workflow together with a reference genome and optional supporting reference data. It aligns reads and performs extensive general NGS and aDNA-specific quality control on the results.\n\n\n## Required & Optional Inputs\nTo run this workflow successfully, you need to provide the following input datasets and parameters:\n\n* **`Input reads` :** Input single-end FASTQ reads for the sample.\n* **`Reference genome` :** Reference genome sequence in FASTA format. This is essential for read mapping and variant calling.\n* **`Choose Mapper` :** Switch to select the alignment tool. Choose between BWA and Bowtie2.\n* **`Hap Map ChrX reference` :** HapMap dataset required for X-chromosome contamination estimation in ANGSD.\n* **`Input Mitochondrial Chromosome Name` :** The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS).\n* **`Kraken2 database directory` :** The database directory required for Kraken2 taxonomic classification.\n* **`Optional BED file for Sex.DetERRmine` :** An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms.\n* **`ANGSD region parameter` :** The specific genomic region to restrict the ANGSD analysis (typically 'X' for human male nuclear contamination estimation).\n\n\n## Workflow Steps\nBy default the pipeline currently performs the following:\n\n## 1. Preprocessing and Quality Control\n* **Quality Control:** Evaluates read quality before and after trimming (`FastQC`)\n* **Adapter Trimming:** Removes adapter sequences (`AdapterRemoval`)\n\n## 2. Read Mapping and Processing\n* **Alignment:** Maps reads to the provided reference genome conditionally using either (`BWA`) or (`Bowtie2`) based on user selection\n* **Filtering and Statistics:** Separates unmapped reads and calculates alignment statistics (`Samtools View and Flagstat`)\n* **Duplicate Removal:** Detects and marks PCR duplicates (`Picard MarkDuplicates`)\n* **Alignment Quality:** Generates detailed BAM quality metrics (`QualiMap BamQC`)\n* **Library Complexity:** Estimates library complexity (`Preseq`)\n\n## 3. Ancient DNA (aDNA) Analysis\n* **Damage Profiling:** Visualizes aDNA-specific C-to-T damage patterns (`mapDamage`)\n* **Endogenous Content:** Calculates the proportion of endogenous (target) DNA in the sample (`EndorSpy`)\n* **(`Optional`) Contamination:** Estimates nuclear X-chromosome contamination conditionally if HapMap data is provided (`ANGSD X-Contamination`)\n\n## 4. Biological Information\n* **Sex Determination:** Determines biological sex based on relative chromosome coverage ratio. This step adapts conditionally whether an optional BED file is provided (`Sex.DetERRmine`)\n* **Mt/Nuc Ratio:** Calculates the ratio of mitochondrial reads to nuclear reads utilizing the specified mitochondrial chromosome name (`MtNucRatioCalculator`)\n\n## 5. Genotyping\n* **Variant Analysis:** Performs variant calling to generate VCF files (`FreeBayes`)\n* **Variant Statistics:** Calculates statistics for the generated variants (`Bcftools stats`)\n\n## 6. Metagenomic Screening (For Unmapped Reads)\n* **Read Extraction:** Extracts unmapped reads for microbial analysis (`Picard SamToFastq`)\n* **Quality Filter:** Filters low-complexity sequences (`BBTools BBduk`)\n* **Taxonomic Classification:** Performs microbiome/taxonomic screening on the filtered unmapped reads (`Kraken2`)\n\n## 7. Reporting\n* **Summary Report:** Aggregates logs and statistics from all these tools into a single interactive HTML report (`MultiQC`)\n\n\n## Workflow Outputs\nUpon successful execution, the workflow explicitly provides the following final files for analysis:\n\n* **`MultiQC aggregated workflow summary report` :** An interactive HTML report aggregating QC and analysis logs from all tools.\n* **`QualiMap BamQC general alignment quality metrics report` :** A detailed HTML report containing mapping quality metrics, GC content, and coverage statistics.\n* **`mapDamage Visualisation` :** Visual plots displaying the characteristic C-to-T deamination patterns at the ends of ancient DNA reads.\n* **`Kraken2 taxonomic classification and microbial screening report` :** A tabular report showing the taxonomic classification of unmapped reads.\n* **`EndorSpy endogenous DNA authentication report` :** A JSON file containing the calculated endogenous DNA percentage.\n* **`Sex.DetERRmine (Without BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for human-genome alignments.\n* **`Sex.DetERRmine (With BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for targeted capture regions.\n* **`Mitochondrial to nuclear DNA ratio calculation report` :** A JSON file containing the calculated ratio between mitochondrial and nuclear reads.\n* **`ANGSD report of nuclear contamination estimation` :** A tabular text file detailing the estimates of nuclear X-chromosome contamination.\n* **`Bcftools variant calling summary statistics report` :** A text file containing comprehensive summary statistics for the called variants (VCF).\n* **`Fully post-processed mapping results` :** The final deduplicated and filtered alignment BAM file.\n* **`Freebayes raw genomic variant calls` :** The raw VCF file generated from variant analysis.\n\n\n## Testing Data\nTo ensure the workflow functions correctly, it was validated using the following datasets and databases:\n\n* **`Primary Test Data` :** A downsampled single-end FASTQ dataset (`NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz`) optimized for rapid workflow testing and validation.\n* **`Primary Reference Genome` :** The [hs37d5_chr21-MT.fa.gz](https://github.com/nf-core/test-datasets/blob/eager/reference/Human/hs37d5_chr21-MT.fa.gz) file was utilized as the primary reference genome sequence.\n* **`X-Chromosome Contamination Reference` :** The [HapMap ChrX](https://github.com/ANGSD/angsd/blob/master/RES/HapMapChrX.gz) dataset was provided as the initial reference for the estimation of X-chromosome contamination using the ANGSD tool.\n* **`Taxonomic Classification Database` :** The Minikraken v2 database was utilized to perform taxonomic classification via Kraken2.", "report": { @@ -1859,4 +1860,4 @@ "tags": [], "uuid": "e45fbf34-717f-4429-847e-c704938d89c9", "version": 145 -} \ No newline at end of file +} From d113ab3c71616e3e807b6d37844a75b1886d8a40 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Mert=20Ayd=C4=B1n?= <56894545+mertydn@users.noreply.github.com> Date: Mon, 18 May 2026 19:40:25 +0200 Subject: [PATCH 05/17] Update Kraken2 database directory in workflow changing to a smaller db due to memory restrictions --- workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml index 7b17fdd055..81d689b861 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml +++ b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml @@ -14,7 +14,7 @@ filetype: gz Choose Mapper: BWA Optional BED file for Sex.DetERRmine: null - Kraken2 database directory: k2_standard_20210517 + Kraken2 database directory: kraken2_viral_db outputs: Fully post-processed mapping results: asserts: From 48a96e0d4bfb0d80f0c1b2c774eacd7125ecb715 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Mert=20Ayd=C4=B1n?= <56894545+mertydn@users.noreply.github.com> Date: Tue, 19 May 2026 11:42:38 +0200 Subject: [PATCH 06/17] Update Kraken2 database directory in workflow --- workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml index 81d689b861..825001b3df 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml +++ b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml @@ -14,7 +14,7 @@ filetype: gz Choose Mapper: BWA Optional BED file for Sex.DetERRmine: null - Kraken2 database directory: kraken2_viral_db + Kraken2 database directory: viral2019-03 outputs: Fully post-processed mapping results: asserts: From b8d5a15d1ed87797295e0d355b23c38e1195c26d Mon Sep 17 00:00:00 2001 From: Ubuntu Date: Mon, 6 Jul 2026 11:33:40 +0000 Subject: [PATCH 07/17] fix: resolve multiqc collection crash and split PE reads into R1/R2 lists --- .../adna-analysis/adna-analysis.ga | 1286 ++++++++++++----- 1 file changed, 920 insertions(+), 366 deletions(-) diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis.ga b/workflows/paleogenomics/adna-analysis/adna-analysis.ga index 5a652cece4..f654972082 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis.ga +++ b/workflows/paleogenomics/adna-analysis/adna-analysis.ga @@ -27,138 +27,165 @@ "inputs": [ { "description": "Input single-end FASTQ reads for the sample.", - "name": "Input reads" + "name": "Input Single-end reads" } ], - "label": "Input reads", - "name": "Input dataset", + "label": "Input Single-end reads", + "name": "Input dataset collection", "outputs": [], "position": { - "left": 0.1056357854538455, - "top": 184.41450948321622 + "left": 2.664238753812611, + "top": 300.32481222623755 }, "tool_id": null, - "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_state": "{\"optional\": true, \"format\": [\"fastq.gz\", \"fastqsanger.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", "tool_version": null, - "type": "data_input", - "uuid": "f9a7939b-414a-437a-91b8-cdbfb17a0203", + "type": "data_collection_input", + "uuid": "f7d7cb77-f9c3-4f80-8c20-a4891e9cbde2", "when": null, "workflow_outputs": [] }, "1": { - "annotation": "Switch to select the alignment tool.", + "annotation": "Select the sequencing read type of your input data: Single-End (SE) or Paired-End (PE).", "content_id": null, "errors": null, "id": 1, "input_connections": {}, "inputs": [ { - "description": "Switch to select the alignment tool.", - "name": "Choose Mapper" + "description": "Select the sequencing read type of your input data: Single-End (SE) or Paired-End (PE).", + "name": "Choose Read Type" } ], - "label": "Choose Mapper", + "label": "Choose Read Type", "name": "Input parameter", "outputs": [], "position": { - "left": 0, - "top": 988.1275633734917 + "left": 2.4392460205062036, + "top": 537.0611572485416 }, "tool_id": null, - "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictions\": [\"BWA\", \"Bowtie2\"], \"parameter_type\": \"text\", \"optional\": false}", + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictions\": [\"Single-End\", \"Paired-End\"], \"parameter_type\": \"text\", \"optional\": false}", "tool_version": null, "type": "parameter_input", - "uuid": "6fb6f861-a6bf-4cc7-9afd-0bbbcb8d6c6c", + "uuid": "14d93c50-9e41-47c7-ae44-2370ec91b23f", "when": null, "workflow_outputs": [] }, "2": { - "annotation": "An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms.", + "annotation": "Input paired-end Forward FASTQ reads for the sample. Please ensure that the files in this collection are sorted alphabetically so they correctly match the R2/R1 files.", "content_id": null, "errors": null, "id": 2, "input_connections": {}, "inputs": [ { - "description": "An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms.", - "name": "Optional BED file for Sex.DetERRmine" + "description": "Input paired-end Forward FASTQ reads for the sample. Please ensure that the files in this collection are sorted alphabetically so they correctly match the R2/R1 files.", + "name": "Input Paired-end Forward reads (R1)" } ], - "label": "Optional BED file for Sex.DetERRmine", - "name": "Input dataset", + "label": "Input Paired-end Forward reads (R1)", + "name": "Input dataset collection", "outputs": [], "position": { - "left": 1199.7684534476482, - "top": 173.01636542117905 + "left": 0.8459904296868501, + "top": 802.3999907606233 }, "tool_id": null, - "tool_state": "{\"optional\": true, \"tag\": null}", + "tool_state": "{\"optional\": true, \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", "tool_version": null, - "type": "data_input", - "uuid": "ab2309d8-46e7-4142-a5fa-f35008e090d8", + "type": "data_collection_input", + "uuid": "182acaba-5521-4972-9d17-c51a485160f9", "when": null, "workflow_outputs": [] }, "3": { - "annotation": "The specific genomic region to restrict the ANGSD analysis (typically 'X' for human male nuclear contamination estimation).", + "annotation": "Input paired-end Reverse FASTQ reads for the sample. Please ensure that the files in this collection are sorted alphabetically so they correctly match the R2/R1 files.", "content_id": null, "errors": null, "id": 3, "input_connections": {}, "inputs": [ { - "description": "The specific genomic region to restrict the ANGSD analysis (typically 'X' for human male nuclear contamination estimation).", - "name": "ANGSD region parameter" + "description": "Input paired-end Reverse FASTQ reads for the sample. Please ensure that the files in this collection are sorted alphabetically so they correctly match the R2/R1 files.", + "name": "Input Paired-end reverse reads (R2)" } ], - "label": "ANGSD region parameter", - "name": "Input parameter", + "label": "Input Paired-end reverse reads (R2)", + "name": "Input dataset collection", "outputs": [], "position": { - "left": 1601.387335993921, - "top": 798.3690333992074 + "left": 0, + "top": 920.0000578992951 }, "tool_id": null, - "tool_state": "{\"default\": \"X:5000000-154900000\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_state": "{\"optional\": true, \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", "tool_version": null, - "type": "parameter_input", - "uuid": "74a40872-f977-4ebb-8eb0-7bfa6508ca74", + "type": "data_collection_input", + "uuid": "8bc74801-26a1-4ea3-90a4-46ba6d8ee2eb", "when": null, "workflow_outputs": [] }, "4": { - "annotation": "The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS).", + "annotation": "Switch to select the alignment tool.", "content_id": null, "errors": null, "id": 4, "input_connections": {}, "inputs": [ { - "description": "The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS).", - "name": "Input Mitochondrial Chromosome Name" + "description": "Switch to select the alignment tool.", + "name": "Choose Mapper" } ], - "label": "Input Mitochondrial Chromosome Name", + "label": "Choose Mapper", "name": "Input parameter", "outputs": [], "position": { - "left": 1602.3933158974728, - "top": 1376.8717022918875 + "left": 800.5964115821553, + "top": 1023.6124942727342 }, "tool_id": null, - "tool_state": "{\"default\": \"MT\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictions\": [\"BWA\", \"Bowtie2\"], \"parameter_type\": \"text\", \"optional\": false}", "tool_version": null, "type": "parameter_input", - "uuid": "3dda9710-d18b-4622-90d9-4bfba0cda536", + "uuid": "6fb6f861-a6bf-4cc7-9afd-0bbbcb8d6c6c", "when": null, "workflow_outputs": [] }, "5": { - "annotation": "Reference genome sequence in FASTA format.", + "annotation": "An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms.", "content_id": null, "errors": null, "id": 5, "input_connections": {}, + "inputs": [ + { + "description": "An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms.", + "name": "Optional BED file for Sex.DetERRmine" + } + ], + "label": "Optional BED file for Sex.DetERRmine", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 2001.795258974937, + "top": 253.5786550234967 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "ab2309d8-46e7-4142-a5fa-f35008e090d8", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "Reference genome sequence in FASTA format.", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, "inputs": [ { "description": "Reference genome sequence in FASTA format.", @@ -169,8 +196,8 @@ "name": "Input dataset", "outputs": [], "position": { - "left": 0.4480965455411092, - "top": 2372.3275602030662 + "left": 802.4749020728298, + "top": 2452.8898498053836 }, "tool_id": null, "tool_state": "{\"optional\": false, \"tag\": null}", @@ -180,11 +207,38 @@ "when": null, "workflow_outputs": [] }, - "6": { + "7": { + "annotation": "The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS).", + "content_id": null, + "errors": null, + "id": 7, + "input_connections": {}, + "inputs": [ + { + "description": "The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS).", + "name": "Input Mitochondrial Chromosome Name" + } + ], + "label": "Input Mitochondrial Chromosome Name", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 2404.4201214247614, + "top": 1457.433991894205 + }, + "tool_id": null, + "tool_state": "{\"default\": \"MT\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "3dda9710-d18b-4622-90d9-4bfba0cda536", + "when": null, + "workflow_outputs": [] + }, + "8": { "annotation": "HapMap dataset required for X-chromosome contamination estimation in ANGSD.", "content_id": null, "errors": null, - "id": 6, + "id": 8, "input_connections": {}, "inputs": [ { @@ -196,8 +250,8 @@ "name": "Input dataset", "outputs": [], "position": { - "left": 2000.089914983151, - "top": 1659.5278606377417 + "left": 2400.9404122326705, + "top": 1577.105977451097 }, "tool_id": null, "tool_state": "{\"optional\": true, \"tag\": null}", @@ -207,15 +261,42 @@ "when": null, "workflow_outputs": [] }, - "7": { - "annotation": "", + "9": { + "annotation": "The specific genomic region to restrict the ANGSD analysis (e.g. 'X:5000000-154900000' for human male nuclear contamination estimation; adjust for your reference).", "content_id": null, "errors": null, - "id": 7, + "id": 9, + "input_connections": {}, + "inputs": [ + { + "description": "The specific genomic region to restrict the ANGSD analysis (e.g. 'X:5000000-154900000' for human male nuclear contamination estimation; adjust for your reference).", + "name": "ANGSD region parameter" + } + ], + "label": "ANGSD region parameter", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 2402.00872824986, + "top": 1668.6777587064632 + }, + "tool_id": null, + "tool_state": "{\"default\": \"X:5000000-154900000\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "74a40872-f977-4ebb-8eb0-7bfa6508ca74", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "Select the Kraken2 database to use for taxonomic classification (Galaxy data table entry name).", + "content_id": null, + "errors": null, + "id": 10, "input_connections": {}, "inputs": [ { - "description": "", + "description": "Select the Kraken2 database to use for taxonomic classification (Galaxy data table entry name).", "name": "Kraken2 database directory" } ], @@ -223,135 +304,115 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 2000.8949373652963, - "top": 1870.952666103986 + "left": 2802.921742892585, + "top": 1951.5149557063037 }, "tool_id": null, - "tool_state": "{\"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", "tool_version": null, "type": "parameter_input", "uuid": "ed8e4694-68ad-4d93-a475-42ba9a9eb7ed", "when": null, "workflow_outputs": [] }, - "8": { + "11": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 8, + "id": 11, "input_connections": { - "input_file": { - "id": 0, + "input_param_type|input_param": { + "id": 1, "output_name": "output" } }, "inputs": [ { - "description": "runtime parameter for tool FastQC", - "name": "adapters" - }, - { - "description": "runtime parameter for tool FastQC", - "name": "contaminants" - }, - { - "description": "runtime parameter for tool FastQC", - "name": "limits" + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" } ], - "label": "FastQC (pre-Trimming)", - "name": "FastQC", + "label": "Map Single-End", + "name": "Map parameter value", "outputs": [ { - "name": "html_file", - "type": "html" - }, - { - "name": "text_file", - "type": "txt" + "name": "output_param_boolean", + "type": "expression.json" } ], "position": { - "left": 350.29213341262863, - "top": 167.11620392894682 + "left": 403.1574299794747, + "top": 426.6428819074531 }, "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "2c64fded1286", - "name": "fastqc", - "owner": "devteam", + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"adapters\": {\"__class__\": \"RuntimeValue\"}, \"contaminants\": {\"__class__\": \"RuntimeValue\"}, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"kmers\": \"7\", \"limits\": {\"__class__\": \"RuntimeValue\"}, \"min_length\": null, \"nogroup\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"Single-End\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.74+galaxy1", + "tool_version": "0.2.0", "type": "tool", - "uuid": "38c90015-94fe-4ec2-b260-c59eb5a5a6c1", + "uuid": "5fa35466-18a8-4f82-8c3d-cbe6ef5e0844", "when": null, "workflow_outputs": [] }, - "9": { + "12": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 9, + "id": 12, "input_connections": { - "input_type_cond|read1": { - "id": 0, + "input_param_type|input_param": { + "id": 1, "output_name": "output" } }, "inputs": [ { - "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", - "name": "fastq_trimming_options" - }, - { - "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", - "name": "input_type_cond" + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" } ], - "label": null, - "name": "AdapterRemoval: remove adapter sequences", + "label": "Map Paired-End", + "name": "Map parameter value", "outputs": [ { - "name": "output_settings", - "type": "txt" - }, - { - "name": "output_truncated", - "type": "fastqsanger" + "name": "output_param_boolean", + "type": "expression.json" } ], "position": { - "left": 350.29213341262863, - "top": 497.11620392894685 + "left": 403.57679737304966, + "top": 659.5872978230395 }, "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "tool_shed_repository": { - "changeset_revision": "40874f772ea1", - "name": "adapter_removal", + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"fastq_merging_options\": {\"collapse\": false, \"minalignmentlength\": \"11\", \"collapse_deterministic\": false, \"collapse_conservatively\": false}, \"fastq_options\": {\"qualitymax\": \"41\", \"mask_degenerate_bases\": false, \"convert_uracils\": false}, \"fastq_trimming_options\": {\"adapter1\": \"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC\", \"adapter2\": \"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA\", \"adapter_list\": {\"__class__\": \"RuntimeValue\"}, \"minadapteroverlap\": \"1\", \"mm\": \"3.0\", \"shift\": \"2\", \"trim5p_cond\": {\"trim5p_param\": \"no\", \"__current_case__\": 0}, \"trim3p_cond\": {\"trim3p_param\": \"no\", \"__current_case__\": 0}, \"trimns\": true, \"maxns\": \"1000\", \"trimqualities\": true, \"sliding_window_cond\": {\"sliding_window_param\": \"no\", \"__current_case__\": 0}, \"minquality\": \"20\", \"preserve5p\": false, \"minlength\": \"30\", \"maxlength\": \"4294967295\"}, \"input_type_cond\": {\"input_type\": \"single\", \"__current_case__\": 0, \"read1\": {\"__class__\": \"ConnectedValue\"}}, \"output_select\": \"none\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"Paired-End\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "2.3.4+galaxy0", + "tool_version": "0.2.0", "type": "tool", - "uuid": "df891e41-1311-41ff-821d-6defc40909f2", + "uuid": "e4bb17bc-3af7-463f-8e5a-278accabf1c9", "when": null, "workflow_outputs": [] }, - "10": { + "13": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 10, + "id": 13, "input_connections": { "input_param_type|input_param": { - "id": 1, + "id": 4, "output_name": "output" } }, @@ -370,8 +431,8 @@ } ], "position": { - "left": 350.65453516320207, - "top": 907.1825011282847 + "left": 1152.6813406904907, + "top": 987.7447907306023 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", @@ -389,14 +450,14 @@ "when": null, "workflow_outputs": [] }, - "11": { + "14": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 11, + "id": 14, "input_connections": { "input_param_type|input_param": { - "id": 1, + "id": 4, "output_name": "output" } }, @@ -415,8 +476,8 @@ } ], "position": { - "left": 350.1073815457526, - "top": 1066.8526379615103 + "left": 1152.1341870730414, + "top": 1147.4149275638279 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", @@ -434,14 +495,14 @@ "when": null, "workflow_outputs": [] }, - "12": { + "15": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 12, + "id": 15, "input_connections": { "input_param_type|input_param": { - "id": 2, + "id": 5, "output_name": "output" } }, @@ -460,8 +521,8 @@ } ], "position": { - "left": 1600.150017502409, - "top": 32.677624278774545 + "left": 2402.1768230296975, + "top": 113.2399138810922 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", @@ -471,7 +532,7 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"null\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"null\", \"to\": \"True\"}, {\"__index__\": 1, \"from\": null, \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", @@ -479,14 +540,14 @@ "when": null, "workflow_outputs": [] }, - "13": { + "16": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 13, + "id": 16, "input_connections": { "input_param_type|input_param": { - "id": 2, + "id": 5, "output_name": "output" } }, @@ -505,8 +566,8 @@ } ], "position": { - "left": 1599.9667721541668, - "top": 253.4701270710153 + "left": 2401.9935776814555, + "top": 334.03241667333293 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", @@ -516,7 +577,7 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"null\", \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"null\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": null, \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", @@ -524,60 +585,606 @@ "when": null, "workflow_outputs": [] }, - "14": { + "17": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", "errors": null, - "id": 14, + "id": 17, "input_connections": { "input_param_type|input_param": { + "id": 8, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": "Map Hap Map reference Present", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 2801.489206621886, + "top": 1488.925751521365 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"null\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": null, \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "aace4dd5-12b7-4dab-a9a4-ff08b1408f44", + "when": null, + "workflow_outputs": [] + }, + "18": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "errors": null, + "id": 18, + "input_connections": { + "input_file": { + "id": 0, + "output_name": "output" + }, + "when": { + "id": 11, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool FastQC", + "name": "adapters" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "contaminants" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "limits" + } + ], + "label": "FastQC (pre-Trimming SE)", + "name": "FastQC", + "outputs": [ + { + "name": "html_file", + "type": "html" + }, + { + "name": "text_file", + "type": "txt" + } + ], + "position": { + "left": 800.8927139355621, + "top": 0 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "tool_shed_repository": { + "changeset_revision": "2c64fded1286", + "name": "fastqc", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapters\": {\"__class__\": \"RuntimeValue\"}, \"contaminants\": {\"__class__\": \"RuntimeValue\"}, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"kmers\": \"7\", \"limits\": {\"__class__\": \"RuntimeValue\"}, \"min_length\": null, \"nogroup\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.74+galaxy1", + "type": "tool", + "uuid": "38c90015-94fe-4ec2-b260-c59eb5a5a6c1", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "19": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", + "errors": null, + "id": 19, + "input_connections": { + "input_type_cond|read1": { + "id": 0, + "output_name": "output" + }, + "when": { + "id": 11, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", + "name": "fastq_trimming_options" + }, + { + "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", + "name": "input_type_cond" + } + ], + "label": "AdapterRemoval (Single-End)", + "name": "AdapterRemoval: remove adapter sequences", + "outputs": [ + { + "name": "output_settings", + "type": "txt" + }, + { + "name": "output_truncated", + "type": "fastqsanger" + } + ], + "position": { + "left": 800.7410158240991, + "top": 323.4981554510791 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "40874f772ea1", + "name": "adapter_removal", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"fastq_merging_options\": {\"collapse\": false, \"minalignmentlength\": \"11\", \"collapse_deterministic\": false, \"collapse_conservatively\": false}, \"fastq_options\": {\"qualitymax\": \"41\", \"mask_degenerate_bases\": false, \"convert_uracils\": false}, \"fastq_trimming_options\": {\"adapter1\": \"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC\", \"adapter2\": \"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA\", \"adapter_list\": {\"__class__\": \"RuntimeValue\"}, \"minadapteroverlap\": \"1\", \"mm\": \"3.0\", \"shift\": \"2\", \"trim5p_cond\": {\"trim5p_param\": \"no\", \"__current_case__\": 0}, \"trim3p_cond\": {\"trim3p_param\": \"no\", \"__current_case__\": 0}, \"trimns\": true, \"maxns\": \"1000\", \"trimqualities\": true, \"sliding_window_cond\": {\"sliding_window_param\": \"no\", \"__current_case__\": 0}, \"minquality\": \"20\", \"preserve5p\": false, \"minlength\": \"30\", \"maxlength\": \"4294967295\"}, \"input_type_cond\": {\"input_type\": \"single\", \"__current_case__\": 0, \"read1\": {\"__class__\": \"ConnectedValue\"}}, \"output_select\": \"none\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3.4+galaxy0", + "type": "tool", + "uuid": "df891e41-1311-41ff-821d-6defc40909f2", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "20": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", + "errors": null, + "id": 20, + "input_connections": { + "input_type_cond|read1": { + "id": 2, + "output_name": "output" + }, + "input_type_cond|read2": { + "id": 3, + "output_name": "output" + }, + "when": { + "id": 12, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", + "name": "fastq_trimming_options" + }, + { + "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", + "name": "input_type_cond" + }, + { + "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", + "name": "input_type_cond" + } + ], + "label": "AdapterRemoval (Paired-End)", + "name": "AdapterRemoval: remove adapter sequences", + "outputs": [ + { + "name": "output_settings", + "type": "txt" + }, + { + "name": "output_forward_truncated", + "type": "fastqsanger" + }, + { + "name": "output_reverse_truncated", + "type": "fastqsanger" + }, + { + "name": "output_collapsed", + "type": "fastqsanger" + } + ], + "position": { + "left": 800.4272149879693, + "top": 598.7935663323203 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "40874f772ea1", + "name": "adapter_removal", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"fastq_merging_options\": {\"collapse\": true, \"minalignmentlength\": \"11\", \"collapse_deterministic\": false, \"collapse_conservatively\": false}, \"fastq_options\": {\"qualitymax\": \"41\", \"mask_degenerate_bases\": false, \"convert_uracils\": false}, \"fastq_trimming_options\": {\"adapter1\": \"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC\", \"adapter2\": \"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA\", \"adapter_list\": {\"__class__\": \"RuntimeValue\"}, \"minadapteroverlap\": \"1\", \"mm\": \"3.0\", \"shift\": \"2\", \"trim5p_cond\": {\"trim5p_param\": \"no\", \"__current_case__\": 0}, \"trim3p_cond\": {\"trim3p_param\": \"no\", \"__current_case__\": 0}, \"trimns\": true, \"maxns\": \"1000\", \"trimqualities\": true, \"sliding_window_cond\": {\"sliding_window_param\": \"no\", \"__current_case__\": 0}, \"minquality\": \"20\", \"preserve5p\": false, \"minlength\": \"30\", \"maxlength\": \"4294967295\"}, \"input_type_cond\": {\"input_type\": \"pair\", \"__current_case__\": 1, \"read1\": {\"__class__\": \"ConnectedValue\"}, \"read2\": {\"__class__\": \"ConnectedValue\"}, \"identify_adapters\": false, \"interleaved_output\": \"no\", \"combined_output\": false}, \"output_select\": [\"output_collapsed\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3.4+galaxy0", + "type": "tool", + "uuid": "719806af-ed50-428a-8ccb-a0f5dccaf623", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "21": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "errors": null, + "id": 21, + "input_connections": { + "input_file": { + "id": 2, + "output_name": "output" + }, + "when": { + "id": 12, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool FastQC", + "name": "adapters" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "contaminants" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "limits" + } + ], + "label": "FastQC (pre-Trimming PE R1)", + "name": "FastQC", + "outputs": [ + { + "name": "html_file", + "type": "html" + }, + { + "name": "text_file", + "type": "txt" + } + ], + "position": { + "left": 800.6375272982082, + "top": 1121.4499730472132 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "tool_shed_repository": { + "changeset_revision": "2c64fded1286", + "name": "fastqc", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapters\": {\"__class__\": \"RuntimeValue\"}, \"contaminants\": {\"__class__\": \"RuntimeValue\"}, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"kmers\": \"7\", \"limits\": {\"__class__\": \"RuntimeValue\"}, \"min_length\": null, \"nogroup\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.74+galaxy1", + "type": "tool", + "uuid": "f0ba3dcf-57c6-4000-87a1-0477a1e6abe1", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "22": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "errors": null, + "id": 22, + "input_connections": { + "input_file": { + "id": 3, + "output_name": "output" + }, + "when": { + "id": 12, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool FastQC", + "name": "adapters" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "contaminants" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "limits" + } + ], + "label": "FastQC (pre-Trimming PE R2)", + "name": "FastQC", + "outputs": [ + { + "name": "html_file", + "type": "html" + }, + { + "name": "text_file", + "type": "txt" + } + ], + "position": { + "left": 801.6371202316329, + "top": 1437.7845037888476 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "tool_shed_repository": { + "changeset_revision": "2c64fded1286", + "name": "fastqc", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapters\": {\"__class__\": \"RuntimeValue\"}, \"contaminants\": {\"__class__\": \"RuntimeValue\"}, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"kmers\": \"7\", \"limits\": {\"__class__\": \"RuntimeValue\"}, \"min_length\": null, \"nogroup\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.74+galaxy1", + "type": "tool", + "uuid": "0413f971-5f19-4890-bd7a-14ce7e0d959c", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "23": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 23, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 19, + "output_name": "output_settings" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 20, + "output_name": "output_settings" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1150.8391358009158, + "top": 515.2350255281333 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "5717f622-448c-46ff-99cc-a03ee9d3d5e2", + "when": null, + "workflow_outputs": [] + }, + "24": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 24, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 19, + "output_name": "output_truncated" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 20, + "output_name": "output_collapsed" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1151.6830505668827, + "top": 692.325647700744 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "c23c8e94-acf0-4931-8155-a0d2f5389a17", + "when": null, + "workflow_outputs": [] + }, + "25": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 25, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 18, + "output_name": "text_file" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 21, + "output_name": "text_file" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1149.6222370659054, + "top": 207.40000546255038 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"RuntimeValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"RuntimeValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "762ac3dd-21f0-47a2-b5de-e5843eb4d678", + "when": null, + "workflow_outputs": [] + }, + "26": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 26, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 18, + "output_name": "text_file" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 22, + "output_name": "text_file" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 1149.9653084516644, + "top": 360.5250110079591 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"RuntimeValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"RuntimeValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "c062d58b-de49-417e-808f-f637182089d3", + "when": null, + "workflow_outputs": [] + }, + "27": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa/0.7.19", + "errors": null, + "id": 27, + "input_connections": { + "input_type|fastq_input1": { + "id": 24, + "output_name": "data_param" + }, + "reference_source|ref_file": { "id": 6, "output_name": "output" + }, + "when": { + "id": 13, + "output_name": "output_param_boolean" } }, "inputs": [ { - "description": "runtime parameter for tool Map parameter value", - "name": "input_param_type" + "description": "runtime parameter for tool Map with BWA", + "name": "input_type" + }, + { + "description": "runtime parameter for tool Map with BWA", + "name": "reference_source" } ], - "label": "Map Hap Map reference Present", - "name": "Map parameter value", + "label": null, + "name": "Map with BWA", "outputs": [ { - "name": "output_param_boolean", - "type": "expression.json" + "name": "bam_output", + "type": "bam" } ], "position": { - "left": 1998.083739285998, - "top": 1365.207073078407 + "left": 1504.0738994943304, + "top": 954.1969735734001 }, "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa/0.7.19", "tool_shed_repository": { - "changeset_revision": "5ac8a4bf7a8d", - "name": "map_param_value", - "owner": "iuc", + "changeset_revision": "1dfc975b48d5", + "name": "bwa", + "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"null\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": null, \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 1, \"n\": \"0.01\", \"o\": \"2\", \"e\": \"-1\", \"i\": \"5\", \"d\": \"10\", \"l\": \"1024\", \"k\": \"2\", \"m\": \"2000000\", \"M\": \"3\", \"O\": \"11\", \"E\": \"4\", \"R\": \"30\", \"q\": \"0\", \"B\": null, \"L\": null}, \"input_type\": {\"input_type_selector\": \"single\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"adv_se_options\": {\"adv_se_options_selector\": \"do_not_set\", \"__current_case__\": 1}}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"set\", \"__current_case__\": 1, \"read_group_id_conditional\": {\"do_auto_name\": true, \"__current_case__\": 0}, \"read_group_sm_conditional\": {\"do_auto_name\": true, \"__current_case__\": 0}, \"PL\": \"ILLUMINA\", \"read_group_lb_conditional\": {\"do_auto_name\": true, \"__current_case__\": 0}, \"CN\": null, \"DS\": null, \"DT\": null, \"FO\": null, \"KS\": null, \"PG\": null, \"PI\": null, \"PU\": null}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.2.0", + "tool_version": "0.7.19", "type": "tool", - "uuid": "aace4dd5-12b7-4dab-a9a4-ff08b1408f44", - "when": null, + "uuid": "d099da6f-ba0d-472d-a27e-4b121b232b8a", + "when": "$(inputs.when)", "workflow_outputs": [] }, - "15": { + "28": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", "errors": null, - "id": 15, + "id": 28, "input_connections": { "input_file": { - "id": 9, - "output_name": "output_truncated" + "id": 24, + "output_name": "data_param" } }, "inputs": [ @@ -607,8 +1214,8 @@ } ], "position": { - "left": 950.1056357854538, - "top": 534.4145094832163 + "left": 1752.1324413127427, + "top": 614.9767990855339 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", @@ -626,79 +1233,22 @@ "when": null, "workflow_outputs": [] }, - "16": { - "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa/0.7.19", - "errors": null, - "id": 16, - "input_connections": { - "input_type|fastq_input1": { - "id": 9, - "output_name": "output_truncated" - }, - "reference_source|ref_file": { - "id": 5, - "output_name": "output" - }, - "when": { - "id": 10, - "output_name": "output_param_boolean" - } - }, - "inputs": [ - { - "description": "runtime parameter for tool Map with BWA", - "name": "input_type" - }, - { - "description": "runtime parameter for tool Map with BWA", - "name": "reference_source" - } - ], - "label": null, - "name": "Map with BWA", - "outputs": [ - { - "name": "bam_output", - "type": "bam" - } - ], - "position": { - "left": 702.0470939670415, - "top": 873.6346839710825 - }, - "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa/0.7.19", - "tool_shed_repository": { - "changeset_revision": "1dfc975b48d5", - "name": "bwa", - "owner": "devteam", - "tool_shed": "toolshed.g2.bx.psu.edu" - }, - "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 1, \"n\": \"0.01\", \"o\": \"2\", \"e\": \"-1\", \"i\": \"5\", \"d\": \"10\", \"l\": \"1024\", \"k\": \"2\", \"m\": \"2000000\", \"M\": \"3\", \"O\": \"11\", \"E\": \"4\", \"R\": \"30\", \"q\": \"0\", \"B\": null, \"L\": null}, \"input_type\": {\"input_type_selector\": \"single\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"adv_se_options\": {\"adv_se_options_selector\": \"do_not_set\", \"__current_case__\": 1}}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"set\", \"__current_case__\": 1, \"read_group_id_conditional\": {\"do_auto_name\": true, \"__current_case__\": 0}, \"read_group_sm_conditional\": {\"do_auto_name\": true, \"__current_case__\": 0}, \"PL\": \"ILLUMINA\", \"read_group_lb_conditional\": {\"do_auto_name\": true, \"__current_case__\": 0}, \"CN\": null, \"DS\": null, \"DT\": null, \"FO\": null, \"KS\": null, \"PG\": null, \"PI\": null, \"PU\": null}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", - "tool_uuid": null, - "tool_version": "0.7.19", - "type": "tool", - "uuid": "d099da6f-ba0d-472d-a27e-4b121b232b8a", - "when": "$(inputs.when)", - "workflow_outputs": [] - }, - "17": { + "29": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.5+galaxy0", "errors": null, - "id": 17, + "id": 29, "input_connections": { "library|input_1": { - "id": 9, - "output_name": "output_truncated" + "id": 24, + "output_name": "data_param" }, "reference_genome|own_file": { - "id": 5, + "id": 6, "output_name": "output" }, "when": { - "id": 11, + "id": 14, "output_name": "output_param_boolean" } }, @@ -721,8 +1271,8 @@ } ], "position": { - "left": 703.0273000312051, - "top": 1099.0275359513378 + "left": 1505.0541055584938, + "top": 1179.5898255536554 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.5+galaxy0", @@ -740,18 +1290,18 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "18": { + "30": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 18, + "id": 30, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 16, + "id": 27, "output_name": "bam_output" }, "style_cond|type_cond|pick_from_1|value": { - "id": 17, + "id": 29, "output_name": "output" } }, @@ -765,8 +1315,8 @@ } ], "position": { - "left": 947.7733887896687, - "top": 948.3909231499435 + "left": 1749.8001943169575, + "top": 1028.9532127522612 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", @@ -784,14 +1334,14 @@ "when": null, "workflow_outputs": [] }, - "19": { + "31": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/preseq_c_curve/preseq_c_curve/3.2.0+galaxy0", "errors": null, - "id": 19, + "id": 31, "input_connections": { "input_bam": { - "id": 18, + "id": 30, "output_name": "data_param" } }, @@ -805,8 +1355,8 @@ } ], "position": { - "left": 1250.1056357854538, - "top": 714.4145094832163 + "left": 2052.1324413127427, + "top": 794.9767990855339 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/preseq_c_curve/preseq_c_curve/3.2.0+galaxy0", @@ -824,14 +1374,14 @@ "when": null, "workflow_outputs": [] }, - "20": { + "32": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", "errors": null, - "id": 20, + "id": 32, "input_connections": { "input1": { - "id": 18, + "id": 30, "output_name": "data_param" } }, @@ -845,8 +1395,8 @@ } ], "position": { - "left": 1250.1056357854538, - "top": 864.4145094832163 + "left": 2052.1324413127427, + "top": 944.9767990855339 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", @@ -864,14 +1414,14 @@ "when": null, "workflow_outputs": [] }, - "21": { + "33": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.22+galaxy1", "errors": null, - "id": 21, + "id": 33, "input_connections": { "input": { - "id": 18, + "id": 30, "output_name": "data_param" } }, @@ -889,8 +1439,8 @@ } ], "position": { - "left": 1250.1056357854538, - "top": 1124.4145094832163 + "left": 2052.1324413127427, + "top": 1204.976799085534 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.22+galaxy1", @@ -908,14 +1458,14 @@ "when": null, "workflow_outputs": [] }, - "22": { + "34": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", "errors": null, - "id": 22, + "id": 34, "input_connections": { "input1": { - "id": 21, + "id": 33, "output_name": "outputsam" } }, @@ -929,8 +1479,8 @@ } ], "position": { - "left": 1600.1056357854538, - "top": 914.4145094832163 + "left": 2402.1324413127427, + "top": 994.9767990855339 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", @@ -948,14 +1498,14 @@ "when": null, "workflow_outputs": [] }, - "23": { + "35": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", "errors": null, - "id": 23, + "id": 35, "input_connections": { "inputFile": { - "id": 21, + "id": 33, "output_name": "outputsam" } }, @@ -973,8 +1523,8 @@ } ], "position": { - "left": 1600.105625861612, - "top": 1124.4145641851394 + "left": 2402.132431388901, + "top": 1204.976853787457 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", @@ -998,14 +1548,14 @@ } ] }, - "24": { + "36": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_SamToFastq/3.1.1.0", "errors": null, - "id": 24, + "id": 36, "input_connections": { "inputFile": { - "id": 21, + "id": 33, "output_name": "invoutputsam" } }, @@ -1035,8 +1585,8 @@ } ], "position": { - "left": 1600.1056357854538, - "top": 1684.4145094832163 + "left": 2402.1324413127427, + "top": 1764.976799085534 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_SamToFastq/3.1.1.0", @@ -1054,18 +1604,18 @@ "when": null, "workflow_outputs": [] }, - "25": { + "37": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/endorspy/endorspy/1.3+galaxy0", "errors": null, - "id": 25, + "id": 37, "input_connections": { "post_flagstat": { - "id": 22, + "id": 34, "output_name": "output1" }, "pre_flagstat": { - "id": 20, + "id": 32, "output_name": "output1" } }, @@ -1084,8 +1634,8 @@ } ], "position": { - "left": 2002.5248625893973, - "top": 659.2716922696325 + "left": 2804.551668116686, + "top": 739.8339818719501 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/endorspy/endorspy/1.3+galaxy0", @@ -1109,18 +1659,18 @@ } ] }, - "26": { + "38": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", "errors": null, - "id": 26, + "id": 38, "input_connections": { "input_bam": { - "id": 23, + "id": 35, "output_name": "outFile" }, "when": { - "id": 12, + "id": 15, "output_name": "output_param_boolean" } }, @@ -1143,8 +1693,8 @@ } ], "position": { - "left": 2001.600044364478, - "top": 0.0 + "left": 2803.6268498917666, + "top": 80.56228960231766 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", @@ -1168,22 +1718,22 @@ } ] }, - "27": { + "39": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", "errors": null, - "id": 27, + "id": 39, "input_connections": { "input_bam": { - "id": 23, + "id": 35, "output_name": "outFile" }, "input_bed": { - "id": 2, + "id": 5, "output_name": "output" }, "when": { - "id": 13, + "id": 16, "output_name": "output_param_boolean" } }, @@ -1201,8 +1751,8 @@ } ], "position": { - "left": 2000.0499611910461, - "top": 334.0709520237296 + "left": 2802.076766718335, + "top": 414.63324162604727 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", @@ -1226,14 +1776,14 @@ } ] }, - "28": { + "40": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.3+galaxy0", "errors": null, - "id": 28, + "id": 40, "input_connections": { "input1": { - "id": 23, + "id": 35, "output_name": "outFile" } }, @@ -1251,8 +1801,8 @@ } ], "position": { - "left": 2001.1320029417996, - "top": 888.0165040989987 + "left": 2803.1588084690884, + "top": 968.5787937013163 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.3+galaxy0", @@ -1276,18 +1826,18 @@ } ] }, - "29": { + "41": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/mtnucratio/mtnucratio/0.7.1+galaxy0", "errors": null, - "id": 29, + "id": 41, "input_connections": { "input_bam": { - "id": 23, + "id": 35, "output_name": "outFile" }, "mt_chrom_name": { - "id": 4, + "id": 7, "output_name": "output" } }, @@ -1305,8 +1855,8 @@ } ], "position": { - "left": 2000.0999244419543, - "top": 1101.2232848477568 + "left": 2802.1267427108824, + "top": 1181.7750121706536 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/mtnucratio/mtnucratio/0.7.1+galaxy0", @@ -1330,22 +1880,22 @@ } ] }, - "30": { + "42": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd/0.940+galaxy0", "errors": null, - "id": 30, + "id": 42, "input_connections": { "input_bams": { - "id": 23, + "id": 35, "output_name": "outFile" }, "region": { - "id": 3, + "id": 9, "output_name": "output" }, "when": { - "id": 14, + "id": 17, "output_name": "output_param_boolean" } }, @@ -1359,8 +1909,8 @@ } ], "position": { - "left": 1999.262376063348, - "top": 1502.4949580714795 + "left": 2803.1212763913077, + "top": 1655.3335320483018 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd/0.940+galaxy0", @@ -1378,18 +1928,18 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "31": { + "43": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_damage/map_damage/2.2.3+galaxy0", "errors": null, - "id": 31, + "id": 43, "input_connections": { "reference|history_reference": { - "id": 5, + "id": 6, "output_name": "output" }, "sbam_file": { - "id": 23, + "id": 35, "output_name": "outFile" } }, @@ -1412,8 +1962,8 @@ } ], "position": { - "left": 2000.799910004207, - "top": 1961.2829113704156 + "left": 2802.8267155314957, + "top": 2041.8452009727332 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_damage/map_damage/2.2.3+galaxy0", @@ -1437,18 +1987,18 @@ } ] }, - "32": { + "44": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/freebayes/freebayes/1.3.10+galaxy1", "errors": null, - "id": 32, + "id": 44, "input_connections": { "reference_source|batchmode|input_bams": { - "id": 23, + "id": 35, "output_name": "outFile" }, "reference_source|ref_file": { - "id": 5, + "id": 6, "output_name": "output" } }, @@ -1467,8 +2017,8 @@ } ], "position": { - "left": 2000.2250735220819, - "top": 2247.9675767022045 + "left": 2802.2518790493705, + "top": 2328.529866304522 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/freebayes/freebayes/1.3.10+galaxy1", @@ -1492,14 +2042,14 @@ } ] }, - "33": { + "45": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bbtools_bbduk/bbtools_bbduk/39.08+galaxy4", "errors": null, - "id": 33, + "id": 45, "input_connections": { "input_type_cond|read1": { - "id": 24, + "id": 36, "output_name": "fq_single" } }, @@ -1518,8 +2068,8 @@ } ], "position": { - "left": 2000.0999862818837, - "top": 1748.9171112950867 + "left": 2802.1267918091726, + "top": 1829.4794008974043 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bbtools_bbduk/bbtools_bbduk/39.08+galaxy4", @@ -1537,18 +2087,18 @@ "when": null, "workflow_outputs": [] }, - "34": { + "46": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 34, + "id": 46, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 26, + "id": 38, "output_name": "output_json" }, "style_cond|type_cond|pick_from_1|value": { - "id": 27, + "id": 39, "output_name": "output_json" } }, @@ -1562,8 +2112,8 @@ } ], "position": { - "left": 2412.6501900376466, - "top": 302.25264495281465 + "left": 3214.676995564935, + "top": 382.8149345551323 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", @@ -1581,22 +2131,22 @@ "when": null, "workflow_outputs": [] }, - "35": { + "47": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd_contamination/0.940+galaxy0", "errors": null, - "id": 35, + "id": 47, "input_connections": { "hapmap_file": { - "id": 6, + "id": 8, "output_name": "output" }, "icnts_file": { - "id": 30, + "id": 42, "output_name": "output_icnts" }, "when": { - "id": 14, + "id": 17, "output_name": "output_param_boolean" } }, @@ -1610,8 +2160,8 @@ } ], "position": { - "left": 2298.7992105919184, - "top": 1464.4145655492782 + "left": 3100.826016119207, + "top": 1544.9768551515958 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd_contamination/0.940+galaxy0", @@ -1635,18 +2185,18 @@ } ] }, - "36": { + "48": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_stats/bcftools_stats/1.22+galaxy0", "errors": null, - "id": 36, + "id": 48, "input_connections": { "input_file": { - "id": 32, + "id": 44, "output_name": "output_vcf" }, "sec_default|reference_source|fasta_ref": { - "id": 5, + "id": 6, "output_name": "output" } }, @@ -1673,8 +2223,8 @@ } ], "position": { - "left": 2300.105635785454, - "top": 2304.414509483216 + "left": 3102.1324413127427, + "top": 2384.9767990855335 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_stats/bcftools_stats/1.22+galaxy0", @@ -1698,18 +2248,18 @@ } ] }, - "37": { + "49": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/kraken2/kraken2/2.17.1+galaxy0", "errors": null, - "id": 37, + "id": 49, "input_connections": { "kraken2_database": { - "id": 7, + "id": 10, "output_name": "output" }, "single_paired|input_sequences": { - "id": 33, + "id": 45, "output_name": "outputu" } }, @@ -1732,8 +2282,8 @@ } ], "position": { - "left": 2301.0873331369503, - "top": 1780.1526204372663 + "left": 3103.114138664239, + "top": 1860.7149100395839 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/kraken2/kraken2/2.17.1+galaxy0", @@ -1757,58 +2307,62 @@ } ] }, - "38": { + "50": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.34+galaxy0", "errors": null, - "id": 38, + "id": 50, "input_connections": { "results_0|software_cond|output_0|input": { - "id": 8, - "output_name": "text_file" + "id": 25, + "output_name": "data_param" + }, + "results_0|software_cond|output_1|input": { + "id": 26, + "output_name": "data_param" }, "results_10|software_cond|input": { - "id": 31, + "id": 43, "output_name": "damage_visualisation" }, "results_11|software_cond|input": { - "id": 36, + "id": 48, "output_name": "output_file" }, "results_1|software_cond|input": { - "id": 9, - "output_name": "output_settings" + "id": 23, + "output_name": "data_param" }, "results_2|software_cond|output_0|input": { - "id": 15, + "id": 28, "output_name": "text_file" }, "results_3|software_cond|input": { - "id": 19, + "id": 31, "output_name": "output_tsv" }, "results_4|software_cond|output_0|type|input": { - "id": 20, + "id": 32, "output_name": "output1" }, "results_5|software_cond|output_0|type|input": { - "id": 22, + "id": 34, "output_name": "output1" }, "results_6|software_cond|output_0|input": { - "id": 23, + "id": 35, "output_name": "metrics_file" }, "results_7|software_cond|input": { - "id": 34, + "id": 46, "output_name": "data_param" }, "results_8|software_cond|input": { - "id": 28, - "output_name": "raw_data" + "id": 40, + "output_name": "output_html" }, "results_9|software_cond|input": { - "id": 37, + "id": 49, "output_name": "report_output" } }, @@ -1831,8 +2385,8 @@ } ], "position": { - "left": 2925.668180337298, - "top": 472.5864256941641 + "left": 3727.6875, + "top": 551.5250244140625 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.34+galaxy0", @@ -1842,7 +2396,7 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"comment\": \"\", \"export\": false, \"flat\": false, \"image_content_input\": {\"__class__\": \"RuntimeValue\"}, \"png_plots\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"fastqc\", \"__current_case__\": 9, \"output\": [{\"__index__\": 0, \"type\": \"data\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"adapterremoval\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"fastqc\", \"__current_case__\": 9, \"output\": [{\"__index__\": 0, \"type\": \"data\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 3, \"software_cond\": {\"software\": \"preseq\", \"__current_case__\": 44, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 4, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 25, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"flagstat\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}, {\"__index__\": 5, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 25, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"flagstat\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}, {\"__index__\": 6, \"software_cond\": {\"software\": \"picard\", \"__current_case__\": 18, \"output\": [{\"__index__\": 0, \"type\": \"markdups\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 7, \"software_cond\": {\"software\": \"sexdeterrmine\", \"__current_case__\": 43, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 8, \"software_cond\": {\"software\": \"qualimap\", \"__current_case__\": 21, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 9, \"software_cond\": {\"software\": \"kraken\", \"__current_case__\": 34, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 10, \"software_cond\": {\"software\": \"mapdamage\", \"__current_case__\": 45, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 11, \"software_cond\": {\"software\": \"bcftools\", \"__current_case__\": 2, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"title\": \"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"comment\": \"\", \"export\": false, \"flat\": false, \"image_content_input\": {\"__class__\": \"RuntimeValue\"}, \"png_plots\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"fastqc\", \"__current_case__\": 9, \"output\": [{\"__index__\": 0, \"type\": \"data\", \"input\": {\"__class__\": \"RuntimeValue\"}}, {\"__index__\": 1, \"type\": \"data\", \"input\": {\"__class__\": \"RuntimeValue\"}}]}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"adapterremoval\", \"__current_case__\": 0, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"fastqc\", \"__current_case__\": 9, \"output\": [{\"__index__\": 0, \"type\": \"data\", \"input\": {\"__class__\": \"RuntimeValue\"}}]}}, {\"__index__\": 3, \"software_cond\": {\"software\": \"preseq\", \"__current_case__\": 44, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 4, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 25, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"flagstat\", \"__current_case__\": 1, \"input\": {\"__class__\": \"RuntimeValue\"}}}]}}, {\"__index__\": 5, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 25, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"flagstat\", \"__current_case__\": 1, \"input\": {\"__class__\": \"RuntimeValue\"}}}]}}, {\"__index__\": 6, \"software_cond\": {\"software\": \"picard\", \"__current_case__\": 18, \"output\": [{\"__index__\": 0, \"type\": \"markdups\", \"input\": {\"__class__\": \"RuntimeValue\"}}]}}, {\"__index__\": 7, \"software_cond\": {\"software\": \"sexdeterrmine\", \"__current_case__\": 43, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 8, \"software_cond\": {\"software\": \"qualimap\", \"__current_case__\": 21, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 9, \"software_cond\": {\"software\": \"kraken\", \"__current_case__\": 34, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 10, \"software_cond\": {\"software\": \"mapdamage\", \"__current_case__\": 45, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 11, \"software_cond\": {\"software\": \"bcftools\", \"__current_case__\": 2, \"input\": {\"__class__\": \"RuntimeValue\"}}}], \"title\": \"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "1.34+galaxy0", "type": "tool", @@ -1858,6 +2412,6 @@ } }, "tags": [], - "uuid": "e45fbf34-717f-4429-847e-c704938d89c9", - "version": 145 -} + "uuid": "ef516004-deee-4276-ad79-9d8db07fd7ce", + "version": 5 +} \ No newline at end of file From 4e042e24595dd0b994ee918c5ca85e410785c9a9 Mon Sep 17 00:00:00 2001 From: Ubuntu Date: Mon, 6 Jul 2026 14:05:38 +0000 Subject: [PATCH 08/17] fix: concatenate unmerged PE reads for single-end mapping to prevent data loss --- .../paleogenomics/adna-analysis/README.md | 5 +- .../adna-analysis/adna-analysis-tests.yml | 13 +- .../adna-analysis/adna-analysis.ga | 551 ++++++++++-------- 3 files changed, 312 insertions(+), 257 deletions(-) diff --git a/workflows/paleogenomics/adna-analysis/README.md b/workflows/paleogenomics/adna-analysis/README.md index 721586faa5..a413c99ee5 100644 --- a/workflows/paleogenomics/adna-analysis/README.md +++ b/workflows/paleogenomics/adna-analysis/README.md @@ -7,7 +7,10 @@ The pipeline processes the sequencing-read input provided to the workflow togeth ## Required & Optional Inputs To run this workflow successfully, you need to provide the following input datasets and parameters: -* **`Input reads` :** Input single-end FASTQ reads for the sample. +* **`Choose Read Type` :** Select whether your input is Single-End or Paired-End. +* **`Input Single-end reads` :** Input single-end FASTQ reads (list collection) for the sample. +* **`Input Paired-end Forward reads (R1)` :** Input paired-end forward FASTQ reads (list collection) for the sample. +* **`Input Paired-end reverse reads (R2)` :** Input paired-end reverse FASTQ reads (list collection) for the sample. * **`Reference genome` :** Reference genome sequence in FASTA format. This is essential for read mapping and variant calling. * **`Choose Mapper` :** Switch to select the alignment tool. Choose between BWA and Bowtie2. * **`Hap Map ChrX reference` :** HapMap dataset required for X-chromosome contamination estimation in ANGSD. diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml index 825001b3df..40e8250adb 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml +++ b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml @@ -1,9 +1,14 @@ - doc: Test outline for adna-analysis.ga job: - Input reads: - class: File - location: https://zenodo.org/records/20271974/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz - filetype: fastqsanger.gz + Choose Read Type: Single-End + Input Single-end reads: + class: Collection + collection_type: list + elements: + - class: File + identifier: NIST7035 + location: https://zenodo.org/records/20271974/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz + filetype: fastqsanger.gz Reference genome: class: File location: https://github.com/nf-core/test-datasets/raw/eager/reference/Human/hs37d5_chr21-MT.fa.gz diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis.ga b/workflows/paleogenomics/adna-analysis/adna-analysis.ga index f654972082..903066abc4 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis.ga +++ b/workflows/paleogenomics/adna-analysis/adna-analysis.ga @@ -34,8 +34,8 @@ "name": "Input dataset collection", "outputs": [], "position": { - "left": 2.664238753812611, - "top": 300.32481222623755 + "left": 2.664238753812697, + "top": 289.4272202709404 }, "tool_id": null, "tool_state": "{\"optional\": true, \"format\": [\"fastq.gz\", \"fastqsanger.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", @@ -61,8 +61,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 2.4392460205062036, - "top": 537.0611572485416 + "left": 2.439246020506289, + "top": 526.1635652932443 }, "tool_id": null, "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictions\": [\"Single-End\", \"Paired-End\"], \"parameter_type\": \"text\", \"optional\": false}", @@ -88,8 +88,8 @@ "name": "Input dataset collection", "outputs": [], "position": { - "left": 0.8459904296868501, - "top": 802.3999907606233 + "left": 0.8459904296869354, + "top": 791.502398805326 }, "tool_id": null, "tool_state": "{\"optional\": true, \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", @@ -115,8 +115,8 @@ "name": "Input dataset collection", "outputs": [], "position": { - "left": 0, - "top": 920.0000578992951 + "left": 0.0, + "top": 909.1024659439979 }, "tool_id": null, "tool_state": "{\"optional\": true, \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", @@ -142,8 +142,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 800.5964115821553, - "top": 1023.6124942727342 + "left": 1594.510627584606, + "top": 1441.097440599871 }, "tool_id": null, "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictions\": [\"BWA\", \"Bowtie2\"], \"parameter_type\": \"text\", \"optional\": false}", @@ -169,8 +169,8 @@ "name": "Input dataset", "outputs": [], "position": { - "left": 2001.795258974937, - "top": 253.5786550234967 + "left": 3000.721983263028, + "top": 250.7172256717161 }, "tool_id": null, "tool_state": "{\"optional\": true, \"tag\": null}", @@ -196,8 +196,8 @@ "name": "Input dataset", "outputs": [], "position": { - "left": 802.4749020728298, - "top": 2452.8898498053836 + "left": 1796.9138118486842, + "top": 2815.7042121761183 }, "tool_id": null, "tool_state": "{\"optional\": false, \"tag\": null}", @@ -223,8 +223,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 2404.4201214247614, - "top": 1457.433991894205 + "left": 3398.859031200616, + "top": 1820.2483542649397 }, "tool_id": null, "tool_state": "{\"default\": \"MT\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", @@ -250,8 +250,8 @@ "name": "Input dataset", "outputs": [], "position": { - "left": 2400.9404122326705, - "top": 1577.105977451097 + "left": 3395.379322008525, + "top": 1939.9203398218317 }, "tool_id": null, "tool_state": "{\"optional\": true, \"tag\": null}", @@ -277,8 +277,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 2402.00872824986, - "top": 1668.6777587064632 + "left": 3396.4476380257142, + "top": 2031.492121077198 }, "tool_id": null, "tool_state": "{\"default\": \"X:5000000-154900000\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", @@ -304,8 +304,8 @@ "name": "Input parameter", "outputs": [], "position": { - "left": 2802.921742892585, - "top": 1951.5149557063037 + "left": 3797.3606526684393, + "top": 2314.3293180770384 }, "tool_id": null, "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", @@ -342,7 +342,7 @@ ], "position": { "left": 403.1574299794747, - "top": 426.6428819074531 + "top": 415.74528995215593 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", @@ -386,8 +386,8 @@ } ], "position": { - "left": 403.57679737304966, - "top": 659.5872978230395 + "left": 403.5767973730499, + "top": 648.6897058677423 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", @@ -431,8 +431,8 @@ } ], "position": { - "left": 1152.6813406904907, - "top": 987.7447907306023 + "left": 2147.120250466345, + "top": 1350.559153101337 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", @@ -476,8 +476,8 @@ } ], "position": { - "left": 1152.1341870730414, - "top": 1147.4149275638279 + "left": 2146.573096848896, + "top": 1510.2292899345625 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", @@ -521,8 +521,8 @@ } ], "position": { - "left": 2402.1768230296975, - "top": 113.2399138810922 + "left": 3401.103547317789, + "top": 110.37848452931166 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", @@ -566,8 +566,8 @@ } ], "position": { - "left": 2401.9935776814555, - "top": 334.03241667333293 + "left": 3400.920301969547, + "top": 331.17098732155233 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", @@ -611,8 +611,8 @@ } ], "position": { - "left": 2801.489206621886, - "top": 1488.925751521365 + "left": 3795.9281163977403, + "top": 1851.7401138920998 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", @@ -632,11 +632,11 @@ }, "18": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", "errors": null, "id": 18, "input_connections": { - "input_file": { + "input_type_cond|read1": { "id": 0, "output_name": "output" }, @@ -647,57 +647,53 @@ }, "inputs": [ { - "description": "runtime parameter for tool FastQC", - "name": "adapters" - }, - { - "description": "runtime parameter for tool FastQC", - "name": "contaminants" + "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", + "name": "fastq_trimming_options" }, { - "description": "runtime parameter for tool FastQC", - "name": "limits" + "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", + "name": "input_type_cond" } ], - "label": "FastQC (pre-Trimming SE)", - "name": "FastQC", + "label": "AdapterRemoval (Single-End)", + "name": "AdapterRemoval: remove adapter sequences", "outputs": [ { - "name": "html_file", - "type": "html" + "name": "output_settings", + "type": "txt" }, { - "name": "text_file", - "type": "txt" + "name": "output_truncated", + "type": "fastqsanger" } ], "position": { - "left": 800.8927139355621, - "top": 0 + "left": 782.2025979179566, + "top": 739.0149130947038 }, "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", "tool_shed_repository": { - "changeset_revision": "2c64fded1286", - "name": "fastqc", - "owner": "devteam", + "changeset_revision": "40874f772ea1", + "name": "adapter_removal", + "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"adapters\": {\"__class__\": \"RuntimeValue\"}, \"contaminants\": {\"__class__\": \"RuntimeValue\"}, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"kmers\": \"7\", \"limits\": {\"__class__\": \"RuntimeValue\"}, \"min_length\": null, \"nogroup\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"fastq_merging_options\": {\"collapse\": false, \"minalignmentlength\": \"11\", \"collapse_deterministic\": false, \"collapse_conservatively\": false}, \"fastq_options\": {\"qualitymax\": \"41\", \"mask_degenerate_bases\": false, \"convert_uracils\": false}, \"fastq_trimming_options\": {\"adapter1\": \"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC\", \"adapter2\": \"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA\", \"adapter_list\": {\"__class__\": \"RuntimeValue\"}, \"minadapteroverlap\": \"1\", \"mm\": \"3.0\", \"shift\": \"2\", \"trim5p_cond\": {\"trim5p_param\": \"no\", \"__current_case__\": 0}, \"trim3p_cond\": {\"trim3p_param\": \"no\", \"__current_case__\": 0}, \"trimns\": true, \"maxns\": \"1000\", \"trimqualities\": true, \"sliding_window_cond\": {\"sliding_window_param\": \"no\", \"__current_case__\": 0}, \"minquality\": \"20\", \"preserve5p\": false, \"minlength\": \"30\", \"maxlength\": \"4294967295\"}, \"input_type_cond\": {\"input_type\": \"single\", \"__current_case__\": 0, \"read1\": {\"__class__\": \"ConnectedValue\"}}, \"output_select\": \"none\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "0.74+galaxy1", + "tool_version": "2.3.4+galaxy0", "type": "tool", - "uuid": "38c90015-94fe-4ec2-b260-c59eb5a5a6c1", + "uuid": "df891e41-1311-41ff-821d-6defc40909f2", "when": "$(inputs.when)", "workflow_outputs": [] }, "19": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", "errors": null, "id": 19, "input_connections": { - "input_type_cond|read1": { + "input_file": { "id": 0, "output_name": "output" }, @@ -708,43 +704,47 @@ }, "inputs": [ { - "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", - "name": "fastq_trimming_options" + "description": "runtime parameter for tool FastQC", + "name": "adapters" }, { - "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", - "name": "input_type_cond" + "description": "runtime parameter for tool FastQC", + "name": "contaminants" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "limits" } ], - "label": "AdapterRemoval (Single-End)", - "name": "AdapterRemoval: remove adapter sequences", + "label": "FastQC (pre-Trimming SE)", + "name": "FastQC", "outputs": [ { - "name": "output_settings", - "type": "txt" + "name": "html_file", + "type": "html" }, { - "name": "output_truncated", - "type": "fastqsanger" + "name": "text_file", + "type": "txt" } ], "position": { - "left": 800.7410158240991, - "top": 323.4981554510791 + "left": 1585.0605375620003, + "top": 0.0 }, "post_job_actions": {}, - "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", "tool_shed_repository": { - "changeset_revision": "40874f772ea1", - "name": "adapter_removal", - "owner": "iuc", + "changeset_revision": "2c64fded1286", + "name": "fastqc", + "owner": "devteam", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"fastq_merging_options\": {\"collapse\": false, \"minalignmentlength\": \"11\", \"collapse_deterministic\": false, \"collapse_conservatively\": false}, \"fastq_options\": {\"qualitymax\": \"41\", \"mask_degenerate_bases\": false, \"convert_uracils\": false}, \"fastq_trimming_options\": {\"adapter1\": \"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC\", \"adapter2\": \"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA\", \"adapter_list\": {\"__class__\": \"RuntimeValue\"}, \"minadapteroverlap\": \"1\", \"mm\": \"3.0\", \"shift\": \"2\", \"trim5p_cond\": {\"trim5p_param\": \"no\", \"__current_case__\": 0}, \"trim3p_cond\": {\"trim3p_param\": \"no\", \"__current_case__\": 0}, \"trimns\": true, \"maxns\": \"1000\", \"trimqualities\": true, \"sliding_window_cond\": {\"sliding_window_param\": \"no\", \"__current_case__\": 0}, \"minquality\": \"20\", \"preserve5p\": false, \"minlength\": \"30\", \"maxlength\": \"4294967295\"}, \"input_type_cond\": {\"input_type\": \"single\", \"__current_case__\": 0, \"read1\": {\"__class__\": \"ConnectedValue\"}}, \"output_select\": \"none\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"adapters\": {\"__class__\": \"RuntimeValue\"}, \"contaminants\": {\"__class__\": \"RuntimeValue\"}, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"kmers\": \"7\", \"limits\": {\"__class__\": \"RuntimeValue\"}, \"min_length\": null, \"nogroup\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, - "tool_version": "2.3.4+galaxy0", + "tool_version": "0.74+galaxy1", "type": "tool", - "uuid": "df891e41-1311-41ff-821d-6defc40909f2", + "uuid": "38c90015-94fe-4ec2-b260-c59eb5a5a6c1", "when": "$(inputs.when)", "workflow_outputs": [] }, @@ -802,8 +802,8 @@ } ], "position": { - "left": 800.4272149879693, - "top": 598.7935663323203 + "left": 784.2964630407706, + "top": 999.32811668041 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", @@ -863,8 +863,8 @@ } ], "position": { - "left": 800.6375272982082, - "top": 1121.4499730472132 + "left": 1585.7799744899196, + "top": 322.06332643542777 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", @@ -924,8 +924,8 @@ } ], "position": { - "left": 801.6371202316329, - "top": 1437.7845037888476 + "left": 1592.3513985296054, + "top": 646.7580173451056 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", @@ -945,12 +945,59 @@ }, "23": { "annotation": "", - "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "content_id": "cat1", "errors": null, "id": 23, + "input_connections": { + "input1": { + "id": 20, + "output_name": "output_forward_truncated" + }, + "queries_0|input2": { + "id": 20, + "output_name": "output_reverse_truncated" + }, + "queries_1|input2": { + "id": 20, + "output_name": "output_collapsed" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Concatenate multiple datasets or collections", + "name": "input1" + } + ], + "label": null, + "name": "Concatenate multiple datasets or collections", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1133.172763354761, + "top": 1164.4768961452494 + }, + "post_job_actions": {}, + "tool_id": "cat1", + "tool_state": "{\"input1\": {\"__class__\": \"RuntimeValue\"}, \"queries\": [{\"__index__\": 0, \"input2\": {\"__class__\": \"RuntimeValue\"}}, {\"__index__\": 1, \"input2\": {\"__class__\": \"RuntimeValue\"}}], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "c1ae1c4a-cd58-49fe-9de4-41b983477ddc", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "24": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 24, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 19, + "id": 18, "output_name": "output_settings" }, "style_cond|type_cond|pick_from_1|value": { @@ -968,8 +1015,8 @@ } ], "position": { - "left": 1150.8391358009158, - "top": 515.2350255281333 + "left": 3797.783377292731, + "top": 947.6518390311671 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", @@ -987,19 +1034,19 @@ "when": null, "workflow_outputs": [] }, - "24": { + "25": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 24, + "id": 25, "input_connections": { "style_cond|type_cond|pick_from_0|value": { "id": 19, - "output_name": "output_truncated" + "output_name": "text_file" }, "style_cond|type_cond|pick_from_1|value": { - "id": 20, - "output_name": "output_collapsed" + "id": 21, + "output_name": "text_file" } }, "inputs": [], @@ -1012,8 +1059,8 @@ } ], "position": { - "left": 1151.6830505668827, - "top": 692.325647700744 + "left": 2139.8290063486693, + "top": 204.97457125871202 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", @@ -1027,22 +1074,22 @@ "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", - "uuid": "c23c8e94-acf0-4931-8155-a0d2f5389a17", + "uuid": "762ac3dd-21f0-47a2-b5de-e5843eb4d678", "when": null, "workflow_outputs": [] }, - "25": { + "26": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 25, + "id": 26, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 18, + "id": 19, "output_name": "text_file" }, "style_cond|type_cond|pick_from_1|value": { - "id": 21, + "id": 22, "output_name": "text_file" } }, @@ -1056,8 +1103,8 @@ } ], "position": { - "left": 1149.6222370659054, - "top": 207.40000546255038 + "left": 2140.1790174192392, + "top": 362.3220238725469 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", @@ -1067,27 +1114,27 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"RuntimeValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"RuntimeValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", - "uuid": "762ac3dd-21f0-47a2-b5de-e5843eb4d678", + "uuid": "c062d58b-de49-417e-808f-f637182089d3", "when": null, "workflow_outputs": [] }, - "26": { + "27": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 26, + "id": 27, "input_connections": { "style_cond|type_cond|pick_from_0|value": { "id": 18, - "output_name": "text_file" + "output_name": "output_truncated" }, "style_cond|type_cond|pick_from_1|value": { - "id": 22, - "output_name": "text_file" + "id": 23, + "output_name": "out_file1" } }, "inputs": [], @@ -1100,8 +1147,8 @@ } ], "position": { - "left": 1149.9653084516644, - "top": 360.5250110079591 + "left": 2143.701427857198, + "top": 1117.8768364170646 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", @@ -1111,22 +1158,22 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"RuntimeValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"RuntimeValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "0.2.0", "type": "tool", - "uuid": "c062d58b-de49-417e-808f-f637182089d3", + "uuid": "c23c8e94-acf0-4931-8155-a0d2f5389a17", "when": null, "workflow_outputs": [] }, - "27": { + "28": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa/0.7.19", "errors": null, - "id": 27, + "id": 28, "input_connections": { "input_type|fastq_input1": { - "id": 24, + "id": 27, "output_name": "data_param" }, "reference_source|ref_file": { @@ -1157,8 +1204,8 @@ } ], "position": { - "left": 1504.0738994943304, - "top": 954.1969735734001 + "left": 2498.512809270185, + "top": 1317.0113359441348 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa/0.7.19", @@ -1176,14 +1223,14 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "28": { + "29": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", "errors": null, - "id": 28, + "id": 29, "input_connections": { "input_file": { - "id": 24, + "id": 27, "output_name": "data_param" } }, @@ -1214,8 +1261,8 @@ } ], "position": { - "left": 1752.1324413127427, - "top": 614.9767990855339 + "left": 2746.571351088597, + "top": 977.7911614562686 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", @@ -1233,14 +1280,14 @@ "when": null, "workflow_outputs": [] }, - "29": { + "30": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.5+galaxy0", "errors": null, - "id": 29, + "id": 30, "input_connections": { "library|input_1": { - "id": 24, + "id": 27, "output_name": "data_param" }, "reference_genome|own_file": { @@ -1271,8 +1318,8 @@ } ], "position": { - "left": 1505.0541055584938, - "top": 1179.5898255536554 + "left": 2499.4930153343485, + "top": 1542.40418792439 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.5+galaxy0", @@ -1290,18 +1337,18 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "30": { + "31": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 30, + "id": 31, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 27, + "id": 28, "output_name": "bam_output" }, "style_cond|type_cond|pick_from_1|value": { - "id": 29, + "id": 30, "output_name": "output" } }, @@ -1315,8 +1362,8 @@ } ], "position": { - "left": 1749.8001943169575, - "top": 1028.9532127522612 + "left": 2744.239104092812, + "top": 1391.7675751229958 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", @@ -1334,14 +1381,14 @@ "when": null, "workflow_outputs": [] }, - "31": { + "32": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/preseq_c_curve/preseq_c_curve/3.2.0+galaxy0", "errors": null, - "id": 31, + "id": 32, "input_connections": { "input_bam": { - "id": 30, + "id": 31, "output_name": "data_param" } }, @@ -1355,8 +1402,8 @@ } ], "position": { - "left": 2052.1324413127427, - "top": 794.9767990855339 + "left": 3046.571351088597, + "top": 1157.7911614562686 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/preseq_c_curve/preseq_c_curve/3.2.0+galaxy0", @@ -1374,14 +1421,14 @@ "when": null, "workflow_outputs": [] }, - "32": { + "33": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", "errors": null, - "id": 32, + "id": 33, "input_connections": { "input1": { - "id": 30, + "id": 31, "output_name": "data_param" } }, @@ -1395,8 +1442,8 @@ } ], "position": { - "left": 2052.1324413127427, - "top": 944.9767990855339 + "left": 3046.571351088597, + "top": 1307.7911614562686 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", @@ -1414,14 +1461,14 @@ "when": null, "workflow_outputs": [] }, - "33": { + "34": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.22+galaxy1", "errors": null, - "id": 33, + "id": 34, "input_connections": { "input": { - "id": 30, + "id": 31, "output_name": "data_param" } }, @@ -1439,8 +1486,8 @@ } ], "position": { - "left": 2052.1324413127427, - "top": 1204.976799085534 + "left": 3046.571351088597, + "top": 1567.7911614562686 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.22+galaxy1", @@ -1458,14 +1505,14 @@ "when": null, "workflow_outputs": [] }, - "34": { + "35": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", "errors": null, - "id": 34, + "id": 35, "input_connections": { "input1": { - "id": 33, + "id": 34, "output_name": "outputsam" } }, @@ -1479,8 +1526,8 @@ } ], "position": { - "left": 2402.1324413127427, - "top": 994.9767990855339 + "left": 3396.571351088597, + "top": 1357.7911614562686 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", @@ -1498,14 +1545,14 @@ "when": null, "workflow_outputs": [] }, - "35": { + "36": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", "errors": null, - "id": 35, + "id": 36, "input_connections": { "inputFile": { - "id": 33, + "id": 34, "output_name": "outputsam" } }, @@ -1523,8 +1570,8 @@ } ], "position": { - "left": 2402.132431388901, - "top": 1204.976853787457 + "left": 3396.5713411647553, + "top": 1567.7912161581917 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", @@ -1548,14 +1595,14 @@ } ] }, - "36": { + "37": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_SamToFastq/3.1.1.0", "errors": null, - "id": 36, + "id": 37, "input_connections": { "inputFile": { - "id": 33, + "id": 34, "output_name": "invoutputsam" } }, @@ -1585,8 +1632,8 @@ } ], "position": { - "left": 2402.1324413127427, - "top": 1764.976799085534 + "left": 3396.571351088597, + "top": 2127.7911614562686 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_SamToFastq/3.1.1.0", @@ -1604,18 +1651,18 @@ "when": null, "workflow_outputs": [] }, - "37": { + "38": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/endorspy/endorspy/1.3+galaxy0", "errors": null, - "id": 37, + "id": 38, "input_connections": { "post_flagstat": { - "id": 34, + "id": 35, "output_name": "output1" }, "pre_flagstat": { - "id": 32, + "id": 33, "output_name": "output1" } }, @@ -1634,8 +1681,8 @@ } ], "position": { - "left": 2804.551668116686, - "top": 739.8339818719501 + "left": 3798.9905778925404, + "top": 1102.6483442426847 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/endorspy/endorspy/1.3+galaxy0", @@ -1659,14 +1706,14 @@ } ] }, - "38": { + "39": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", "errors": null, - "id": 38, + "id": 39, "input_connections": { "input_bam": { - "id": 35, + "id": 36, "output_name": "outFile" }, "when": { @@ -1693,8 +1740,8 @@ } ], "position": { - "left": 2803.6268498917666, - "top": 80.56228960231766 + "left": 3802.5535741798576, + "top": 77.70086025053706 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", @@ -1718,14 +1765,14 @@ } ] }, - "39": { + "40": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", "errors": null, - "id": 39, + "id": 40, "input_connections": { "input_bam": { - "id": 35, + "id": 36, "output_name": "outFile" }, "input_bed": { @@ -1751,8 +1798,8 @@ } ], "position": { - "left": 2802.076766718335, - "top": 414.63324162604727 + "left": 3801.003491006426, + "top": 411.77181227426667 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", @@ -1776,14 +1823,14 @@ } ] }, - "40": { + "41": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.3+galaxy0", "errors": null, - "id": 40, + "id": 41, "input_connections": { "input1": { - "id": 35, + "id": 36, "output_name": "outFile" } }, @@ -1801,8 +1848,8 @@ } ], "position": { - "left": 2803.1588084690884, - "top": 968.5787937013163 + "left": 3797.597718244943, + "top": 1331.393156072051 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.3+galaxy0", @@ -1826,14 +1873,14 @@ } ] }, - "41": { + "42": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/mtnucratio/mtnucratio/0.7.1+galaxy0", "errors": null, - "id": 41, + "id": 42, "input_connections": { "input_bam": { - "id": 35, + "id": 36, "output_name": "outFile" }, "mt_chrom_name": { @@ -1855,8 +1902,8 @@ } ], "position": { - "left": 2802.1267427108824, - "top": 1181.7750121706536 + "left": 3796.565652486737, + "top": 1544.5893745413882 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/mtnucratio/mtnucratio/0.7.1+galaxy0", @@ -1880,14 +1927,14 @@ } ] }, - "42": { + "43": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd/0.940+galaxy0", "errors": null, - "id": 42, + "id": 43, "input_connections": { "input_bams": { - "id": 35, + "id": 36, "output_name": "outFile" }, "region": { @@ -1909,8 +1956,8 @@ } ], "position": { - "left": 2803.1212763913077, - "top": 1655.3335320483018 + "left": 3797.560186167162, + "top": 2018.1478944190364 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd/0.940+galaxy0", @@ -1928,18 +1975,18 @@ "when": "$(inputs.when)", "workflow_outputs": [] }, - "43": { + "44": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_damage/map_damage/2.2.3+galaxy0", "errors": null, - "id": 43, + "id": 44, "input_connections": { "reference|history_reference": { "id": 6, "output_name": "output" }, "sbam_file": { - "id": 35, + "id": 36, "output_name": "outFile" } }, @@ -1962,8 +2009,8 @@ } ], "position": { - "left": 2802.8267155314957, - "top": 2041.8452009727332 + "left": 3797.26562530735, + "top": 2404.659563343468 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_damage/map_damage/2.2.3+galaxy0", @@ -1987,14 +2034,14 @@ } ] }, - "44": { + "45": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/freebayes/freebayes/1.3.10+galaxy1", "errors": null, - "id": 44, + "id": 45, "input_connections": { "reference_source|batchmode|input_bams": { - "id": 35, + "id": 36, "output_name": "outFile" }, "reference_source|ref_file": { @@ -2017,8 +2064,8 @@ } ], "position": { - "left": 2802.2518790493705, - "top": 2328.529866304522 + "left": 3796.690788825225, + "top": 2691.3442286752565 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/freebayes/freebayes/1.3.10+galaxy1", @@ -2042,14 +2089,14 @@ } ] }, - "45": { + "46": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bbtools_bbduk/bbtools_bbduk/39.08+galaxy4", "errors": null, - "id": 45, + "id": 46, "input_connections": { "input_type_cond|read1": { - "id": 36, + "id": 37, "output_name": "fq_single" } }, @@ -2068,8 +2115,8 @@ } ], "position": { - "left": 2802.1267918091726, - "top": 1829.4794008974043 + "left": 3796.565701585027, + "top": 2192.2937632681387 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bbtools_bbduk/bbtools_bbduk/39.08+galaxy4", @@ -2087,18 +2134,18 @@ "when": null, "workflow_outputs": [] }, - "46": { + "47": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", "errors": null, - "id": 46, + "id": 47, "input_connections": { "style_cond|type_cond|pick_from_0|value": { - "id": 38, + "id": 39, "output_name": "output_json" }, "style_cond|type_cond|pick_from_1|value": { - "id": 39, + "id": 40, "output_name": "output_json" } }, @@ -2112,8 +2159,8 @@ } ], "position": { - "left": 3214.676995564935, - "top": 382.8149345551323 + "left": 4213.603719853027, + "top": 379.9535052033517 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", @@ -2131,18 +2178,18 @@ "when": null, "workflow_outputs": [] }, - "47": { + "48": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd_contamination/0.940+galaxy0", "errors": null, - "id": 47, + "id": 48, "input_connections": { "hapmap_file": { "id": 8, "output_name": "output" }, "icnts_file": { - "id": 42, + "id": 43, "output_name": "output_icnts" }, "when": { @@ -2160,8 +2207,8 @@ } ], "position": { - "left": 3100.826016119207, - "top": 1544.9768551515958 + "left": 4095.2649258950614, + "top": 1907.7912175223305 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd_contamination/0.940+galaxy0", @@ -2185,14 +2232,14 @@ } ] }, - "48": { + "49": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_stats/bcftools_stats/1.22+galaxy0", "errors": null, - "id": 48, + "id": 49, "input_connections": { "input_file": { - "id": 44, + "id": 45, "output_name": "output_vcf" }, "sec_default|reference_source|fasta_ref": { @@ -2223,8 +2270,8 @@ } ], "position": { - "left": 3102.1324413127427, - "top": 2384.9767990855335 + "left": 4096.571351088597, + "top": 2747.791161456268 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_stats/bcftools_stats/1.22+galaxy0", @@ -2248,18 +2295,18 @@ } ] }, - "49": { + "50": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/kraken2/kraken2/2.17.1+galaxy0", "errors": null, - "id": 49, + "id": 50, "input_connections": { "kraken2_database": { "id": 10, "output_name": "output" }, "single_paired|input_sequences": { - "id": 45, + "id": 46, "output_name": "outputu" } }, @@ -2282,8 +2329,8 @@ } ], "position": { - "left": 3103.114138664239, - "top": 1860.7149100395839 + "left": 4097.553048440093, + "top": 2223.5292724103183 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/kraken2/kraken2/2.17.1+galaxy0", @@ -2307,11 +2354,11 @@ } ] }, - "50": { + "51": { "annotation": "", "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.34+galaxy0", "errors": null, - "id": 50, + "id": 51, "input_connections": { "results_0|software_cond|output_0|input": { "id": 25, @@ -2322,47 +2369,47 @@ "output_name": "data_param" }, "results_10|software_cond|input": { - "id": 43, + "id": 44, "output_name": "damage_visualisation" }, "results_11|software_cond|input": { - "id": 48, + "id": 49, "output_name": "output_file" }, "results_1|software_cond|input": { - "id": 23, + "id": 24, "output_name": "data_param" }, "results_2|software_cond|output_0|input": { - "id": 28, + "id": 29, "output_name": "text_file" }, "results_3|software_cond|input": { - "id": 31, + "id": 32, "output_name": "output_tsv" }, "results_4|software_cond|output_0|type|input": { - "id": 32, + "id": 33, "output_name": "output1" }, "results_5|software_cond|output_0|type|input": { - "id": 34, + "id": 35, "output_name": "output1" }, "results_6|software_cond|output_0|input": { - "id": 35, + "id": 36, "output_name": "metrics_file" }, "results_7|software_cond|input": { - "id": 46, + "id": 47, "output_name": "data_param" }, "results_8|software_cond|input": { - "id": 40, + "id": 41, "output_name": "output_html" }, "results_9|software_cond|input": { - "id": 49, + "id": 50, "output_name": "report_output" } }, @@ -2385,8 +2432,8 @@ } ], "position": { - "left": 3727.6875, - "top": 551.5250244140625 + "left": 4722.126409775854, + "top": 914.3393867847972 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.34+galaxy0", @@ -2396,7 +2443,7 @@ "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" }, - "tool_state": "{\"comment\": \"\", \"export\": false, \"flat\": false, \"image_content_input\": {\"__class__\": \"RuntimeValue\"}, \"png_plots\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"fastqc\", \"__current_case__\": 9, \"output\": [{\"__index__\": 0, \"type\": \"data\", \"input\": {\"__class__\": \"RuntimeValue\"}}, {\"__index__\": 1, \"type\": \"data\", \"input\": {\"__class__\": \"RuntimeValue\"}}]}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"adapterremoval\", \"__current_case__\": 0, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"fastqc\", \"__current_case__\": 9, \"output\": [{\"__index__\": 0, \"type\": \"data\", \"input\": {\"__class__\": \"RuntimeValue\"}}]}}, {\"__index__\": 3, \"software_cond\": {\"software\": \"preseq\", \"__current_case__\": 44, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 4, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 25, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"flagstat\", \"__current_case__\": 1, \"input\": {\"__class__\": \"RuntimeValue\"}}}]}}, {\"__index__\": 5, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 25, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"flagstat\", \"__current_case__\": 1, \"input\": {\"__class__\": \"RuntimeValue\"}}}]}}, {\"__index__\": 6, \"software_cond\": {\"software\": \"picard\", \"__current_case__\": 18, \"output\": [{\"__index__\": 0, \"type\": \"markdups\", \"input\": {\"__class__\": \"RuntimeValue\"}}]}}, {\"__index__\": 7, \"software_cond\": {\"software\": \"sexdeterrmine\", \"__current_case__\": 43, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 8, \"software_cond\": {\"software\": \"qualimap\", \"__current_case__\": 21, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 9, \"software_cond\": {\"software\": \"kraken\", \"__current_case__\": 34, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 10, \"software_cond\": {\"software\": \"mapdamage\", \"__current_case__\": 45, \"input\": {\"__class__\": \"RuntimeValue\"}}}, {\"__index__\": 11, \"software_cond\": {\"software\": \"bcftools\", \"__current_case__\": 2, \"input\": {\"__class__\": \"RuntimeValue\"}}}], \"title\": \"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"comment\": \"\", \"export\": false, \"flat\": false, \"image_content_input\": {\"__class__\": \"RuntimeValue\"}, \"png_plots\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"fastqc\", \"__current_case__\": 9, \"output\": [{\"__index__\": 0, \"type\": \"data\", \"input\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"type\": \"data\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"adapterremoval\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"fastqc\", \"__current_case__\": 9, \"output\": [{\"__index__\": 0, \"type\": \"data\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 3, \"software_cond\": {\"software\": \"preseq\", \"__current_case__\": 44, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 4, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 25, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"flagstat\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}, {\"__index__\": 5, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 25, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"flagstat\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}, {\"__index__\": 6, \"software_cond\": {\"software\": \"picard\", \"__current_case__\": 18, \"output\": [{\"__index__\": 0, \"type\": \"markdups\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 7, \"software_cond\": {\"software\": \"sexdeterrmine\", \"__current_case__\": 43, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 8, \"software_cond\": {\"software\": \"qualimap\", \"__current_case__\": 21, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 9, \"software_cond\": {\"software\": \"kraken\", \"__current_case__\": 34, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 10, \"software_cond\": {\"software\": \"mapdamage\", \"__current_case__\": 45, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 11, \"software_cond\": {\"software\": \"bcftools\", \"__current_case__\": 2, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"title\": \"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "1.34+galaxy0", "type": "tool", @@ -2412,6 +2459,6 @@ } }, "tags": [], - "uuid": "ef516004-deee-4276-ad79-9d8db07fd7ce", - "version": 5 + "uuid": "67c3f34a-1718-401e-84fa-7797efa6cd4a", + "version": 6 } \ No newline at end of file From 030df0b03359cd22cdd7baa0d99f4d0a8ec0bedf Mon Sep 17 00:00:00 2001 From: Ubuntu Date: Mon, 6 Jul 2026 14:22:19 +0000 Subject: [PATCH 09/17] fix: wire when condition for concatenate and update readme inputs --- .../paleogenomics/adna-analysis/adna-analysis.ga | 12 ++++++++---- 1 file changed, 8 insertions(+), 4 deletions(-) diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis.ga b/workflows/paleogenomics/adna-analysis/adna-analysis.ga index 903066abc4..397cd4ac41 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis.ga +++ b/workflows/paleogenomics/adna-analysis/adna-analysis.ga @@ -13,7 +13,7 @@ "license": "MIT", "release": "0.1", "name": "Ancient DNA analysis", - "readme": "# Pipeline Summary\nThis workflow performs an ancient DNA (aDNA) based analysis similar to the one in the [nf-core/eager](https://nf-co.re/eager/2.5.3/) workflow. nf-core/eager is a bioinformatics best-practice processing pipeline for genomic NGS sequencing data, with a focus on ancient DNA data. It is ideal for the (palaeo)genomic analysis of humans, animals, plants, microbes and even microbiomes.\n\nThe pipeline processes the sequencing-read input provided to the workflow together with a reference genome and optional supporting reference data. It aligns reads and performs extensive general NGS and aDNA-specific quality control on the results.\n\n\n## Required & Optional Inputs\nTo run this workflow successfully, you need to provide the following input datasets and parameters:\n\n* **`Input reads` :** Input single-end FASTQ reads for the sample.\n* **`Reference genome` :** Reference genome sequence in FASTA format. This is essential for read mapping and variant calling.\n* **`Choose Mapper` :** Switch to select the alignment tool. Choose between BWA and Bowtie2.\n* **`Hap Map ChrX reference` :** HapMap dataset required for X-chromosome contamination estimation in ANGSD.\n* **`Input Mitochondrial Chromosome Name` :** The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS).\n* **`Kraken2 database directory` :** The database directory required for Kraken2 taxonomic classification.\n* **`Optional BED file for Sex.DetERRmine` :** An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms.\n* **`ANGSD region parameter` :** The specific genomic region to restrict the ANGSD analysis (typically 'X' for human male nuclear contamination estimation).\n\n\n## Workflow Steps\nBy default the pipeline currently performs the following:\n\n## 1. Preprocessing and Quality Control\n* **Quality Control:** Evaluates read quality before and after trimming (`FastQC`)\n* **Adapter Trimming:** Removes adapter sequences (`AdapterRemoval`)\n\n## 2. Read Mapping and Processing\n* **Alignment:** Maps reads to the provided reference genome conditionally using either (`BWA`) or (`Bowtie2`) based on user selection\n* **Filtering and Statistics:** Separates unmapped reads and calculates alignment statistics (`Samtools View and Flagstat`)\n* **Duplicate Removal:** Detects and marks PCR duplicates (`Picard MarkDuplicates`)\n* **Alignment Quality:** Generates detailed BAM quality metrics (`QualiMap BamQC`)\n* **Library Complexity:** Estimates library complexity (`Preseq`)\n\n## 3. Ancient DNA (aDNA) Analysis\n* **Damage Profiling:** Visualizes aDNA-specific C-to-T damage patterns (`mapDamage`)\n* **Endogenous Content:** Calculates the proportion of endogenous (target) DNA in the sample (`EndorSpy`)\n* **(`Optional`) Contamination:** Estimates nuclear X-chromosome contamination conditionally if HapMap data is provided (`ANGSD X-Contamination`)\n\n## 4. Biological Information\n* **Sex Determination:** Determines biological sex based on relative chromosome coverage ratio. This step adapts conditionally whether an optional BED file is provided (`Sex.DetERRmine`)\n* **Mt/Nuc Ratio:** Calculates the ratio of mitochondrial reads to nuclear reads utilizing the specified mitochondrial chromosome name (`MtNucRatioCalculator`)\n\n## 5. Genotyping\n* **Variant Analysis:** Performs variant calling to generate VCF files (`FreeBayes`)\n* **Variant Statistics:** Calculates statistics for the generated variants (`Bcftools stats`)\n\n## 6. Metagenomic Screening (For Unmapped Reads)\n* **Read Extraction:** Extracts unmapped reads for microbial analysis (`Picard SamToFastq`)\n* **Quality Filter:** Filters low-complexity sequences (`BBTools BBduk`)\n* **Taxonomic Classification:** Performs microbiome/taxonomic screening on the filtered unmapped reads (`Kraken2`)\n\n## 7. Reporting\n* **Summary Report:** Aggregates logs and statistics from all these tools into a single interactive HTML report (`MultiQC`)\n\n\n## Workflow Outputs\nUpon successful execution, the workflow explicitly provides the following final files for analysis:\n\n* **`MultiQC aggregated workflow summary report` :** An interactive HTML report aggregating QC and analysis logs from all tools.\n* **`QualiMap BamQC general alignment quality metrics report` :** A detailed HTML report containing mapping quality metrics, GC content, and coverage statistics.\n* **`mapDamage Visualisation` :** Visual plots displaying the characteristic C-to-T deamination patterns at the ends of ancient DNA reads.\n* **`Kraken2 taxonomic classification and microbial screening report` :** A tabular report showing the taxonomic classification of unmapped reads.\n* **`EndorSpy endogenous DNA authentication report` :** A JSON file containing the calculated endogenous DNA percentage.\n* **`Sex.DetERRmine (Without BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for human-genome alignments.\n* **`Sex.DetERRmine (With BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for targeted capture regions.\n* **`Mitochondrial to nuclear DNA ratio calculation report` :** A JSON file containing the calculated ratio between mitochondrial and nuclear reads.\n* **`ANGSD report of nuclear contamination estimation` :** A tabular text file detailing the estimates of nuclear X-chromosome contamination.\n* **`Bcftools variant calling summary statistics report` :** A text file containing comprehensive summary statistics for the called variants (VCF).\n* **`Fully post-processed mapping results` :** The final deduplicated and filtered alignment BAM file.\n* **`Freebayes raw genomic variant calls` :** The raw VCF file generated from variant analysis.\n\n\n## Testing Data\nTo ensure the workflow functions correctly, it was validated using the following datasets and databases:\n\n* **`Primary Test Data` :** A downsampled single-end FASTQ dataset (`NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz`) optimized for rapid workflow testing and validation.\n* **`Primary Reference Genome` :** The [hs37d5_chr21-MT.fa.gz](https://github.com/nf-core/test-datasets/blob/eager/reference/Human/hs37d5_chr21-MT.fa.gz) file was utilized as the primary reference genome sequence.\n* **`X-Chromosome Contamination Reference` :** The [HapMap ChrX](https://github.com/ANGSD/angsd/blob/master/RES/HapMapChrX.gz) dataset was provided as the initial reference for the estimation of X-chromosome contamination using the ANGSD tool.\n* **`Taxonomic Classification Database` :** The Minikraken v2 database was utilized to perform taxonomic classification via Kraken2.", + "readme": "# Pipeline Summary\nThis workflow performs an ancient DNA (aDNA) based analysis similar to the one in the [nf-core/eager](https://nf-co.re/eager/2.5.3/) workflow. nf-core/eager is a bioinformatics best-practice processing pipeline for genomic NGS sequencing data, with a focus on ancient DNA data. It is ideal for the (palaeo)genomic analysis of humans, animals, plants, microbes and even microbiomes.\n\nThe pipeline processes the sequencing-read input provided to the workflow together with a reference genome and optional supporting reference data. It aligns reads and performs extensive general NGS and aDNA-specific quality control on the results.\n\n\n## Required & Optional Inputs\nTo run this workflow successfully, you need to provide the following input datasets and parameters:\n\n\n* **`Input reads` :** Input single-end FASTQ reads for the sample.\n* **`Reference genome` :** Reference genome sequence in FASTA format. This is essential for read mapping and variant calling.\n* **`Choose Mapper` :** Switch to select the alignment tool. Choose between BWA and Bowtie2.\n* **`Hap Map ChrX reference` :** HapMap dataset required for X-chromosome contamination estimation in ANGSD.\n* **`Input Mitochondrial Chromosome Name` :** The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS).\n* **`Kraken2 database directory` :** The database directory required for Kraken2 taxonomic classification.\n* **`Optional BED file for Sex.DetERRmine` :** An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms.\n* **`ANGSD region parameter` :** The specific genomic region to restrict the ANGSD analysis (typically 'X' for human male nuclear contamination estimation).\n\n\n## Workflow Steps\nBy default the pipeline currently performs the following:\n\n## 1. Preprocessing and Quality Control\n* **Quality Control:** Evaluates read quality before and after trimming (`FastQC`)\n* **Adapter Trimming:** Removes adapter sequences (`AdapterRemoval`)\n\n## 2. Read Mapping and Processing\n* **Alignment:** Maps reads to the provided reference genome conditionally using either (`BWA`) or (`Bowtie2`) based on user selection\n* **Filtering and Statistics:** Separates unmapped reads and calculates alignment statistics (`Samtools View and Flagstat`)\n* **Duplicate Removal:** Detects and marks PCR duplicates (`Picard MarkDuplicates`)\n* **Alignment Quality:** Generates detailed BAM quality metrics (`QualiMap BamQC`)\n* **Library Complexity:** Estimates library complexity (`Preseq`)\n\n## 3. Ancient DNA (aDNA) Analysis\n* **Damage Profiling:** Visualizes aDNA-specific C-to-T damage patterns (`mapDamage`)\n* **Endogenous Content:** Calculates the proportion of endogenous (target) DNA in the sample (`EndorSpy`)\n* **(`Optional`) Contamination:** Estimates nuclear X-chromosome contamination conditionally if HapMap data is provided (`ANGSD X-Contamination`)\n\n## 4. Biological Information\n* **Sex Determination:** Determines biological sex based on relative chromosome coverage ratio. This step adapts conditionally whether an optional BED file is provided (`Sex.DetERRmine`)\n* **Mt/Nuc Ratio:** Calculates the ratio of mitochondrial reads to nuclear reads utilizing the specified mitochondrial chromosome name (`MtNucRatioCalculator`)\n\n## 5. Genotyping\n* **Variant Analysis:** Performs variant calling to generate VCF files (`FreeBayes`)\n* **Variant Statistics:** Calculates statistics for the generated variants (`Bcftools stats`)\n\n## 6. Metagenomic Screening (For Unmapped Reads)\n* **Read Extraction:** Extracts unmapped reads for microbial analysis (`Picard SamToFastq`)\n* **Quality Filter:** Filters low-complexity sequences (`BBTools BBduk`)\n* **Taxonomic Classification:** Performs microbiome/taxonomic screening on the filtered unmapped reads (`Kraken2`)\n\n## 7. Reporting\n* **Summary Report:** Aggregates logs and statistics from all these tools into a single interactive HTML report (`MultiQC`)\n\n\n## Workflow Outputs\nUpon successful execution, the workflow explicitly provides the following final files for analysis:\n\n* **`MultiQC aggregated workflow summary report` :** An interactive HTML report aggregating QC and analysis logs from all tools.\n* **`QualiMap BamQC general alignment quality metrics report` :** A detailed HTML report containing mapping quality metrics, GC content, and coverage statistics.\n* **`mapDamage Visualisation` :** Visual plots displaying the characteristic C-to-T deamination patterns at the ends of ancient DNA reads.\n* **`Kraken2 taxonomic classification and microbial screening report` :** A tabular report showing the taxonomic classification of unmapped reads.\n* **`EndorSpy endogenous DNA authentication report` :** A JSON file containing the calculated endogenous DNA percentage.\n* **`Sex.DetERRmine (Without BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for human-genome alignments.\n* **`Sex.DetERRmine (With BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for targeted capture regions.\n* **`Mitochondrial to nuclear DNA ratio calculation report` :** A JSON file containing the calculated ratio between mitochondrial and nuclear reads.\n* **`ANGSD report of nuclear contamination estimation` :** A tabular text file detailing the estimates of nuclear X-chromosome contamination.\n* **`Bcftools variant calling summary statistics report` :** A text file containing comprehensive summary statistics for the called variants (VCF).\n* **`Fully post-processed mapping results` :** The final deduplicated and filtered alignment BAM file.\n* **`Freebayes raw genomic variant calls` :** The raw VCF file generated from variant analysis.\n\n\n## Testing Data\nTo ensure the workflow functions correctly, it was validated using the following datasets and databases:\n\n* **`Primary Test Data` :** A downsampled single-end FASTQ dataset (`NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz`) optimized for rapid workflow testing and validation.\n* **`Primary Reference Genome` :** The [hs37d5_chr21-MT.fa.gz](https://github.com/nf-core/test-datasets/blob/eager/reference/Human/hs37d5_chr21-MT.fa.gz) file was utilized as the primary reference genome sequence.\n* **`X-Chromosome Contamination Reference` :** The [HapMap ChrX](https://github.com/ANGSD/angsd/blob/master/RES/HapMapChrX.gz) dataset was provided as the initial reference for the estimation of X-chromosome contamination using the ANGSD tool.\n* **`Taxonomic Classification Database` :** The Minikraken v2 database was utilized to perform taxonomic classification via Kraken2.", "report": { "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" }, @@ -960,6 +960,10 @@ "queries_1|input2": { "id": 20, "output_name": "output_collapsed" + }, + "when": { + "id": 12, + "output_name": "output_param_boolean" } }, "inputs": [ @@ -986,7 +990,7 @@ "tool_uuid": null, "tool_version": "1.0.0", "type": "tool", - "uuid": "c1ae1c4a-cd58-49fe-9de4-41b983477ddc", + "uuid": "5a3b1eab-9a87-4f33-a266-97fa750ff016", "when": "$(inputs.when)", "workflow_outputs": [] }, @@ -2459,6 +2463,6 @@ } }, "tags": [], - "uuid": "67c3f34a-1718-401e-84fa-7797efa6cd4a", - "version": 6 + "uuid": "d0dae49f-bcad-44c6-9ac9-f2d047290da7", + "version": 8 } \ No newline at end of file From 82e2170d36d4c72e354a4ada0869322867f87478 Mon Sep 17 00:00:00 2001 From: Ubuntu Date: Mon, 6 Jul 2026 14:48:54 +0000 Subject: [PATCH 10/17] test: add paired-end workflow integration test case to planemo suite --- .../adna-analysis/adna-analysis-tests.yml | 106 +++++++++++++++++- 1 file changed, 104 insertions(+), 2 deletions(-) diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml index 40e8250adb..c54bc1b797 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml +++ b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml @@ -1,4 +1,4 @@ -- doc: Test outline for adna-analysis.ga +- doc: Test outline for adna-analysis.ga (Single-End) job: Choose Read Type: Single-End Input Single-end reads: @@ -7,7 +7,7 @@ elements: - class: File identifier: NIST7035 - location: https://zenodo.org/records/20271974/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz + location: https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz filetype: fastqsanger.gz Reference genome: class: File @@ -91,3 +91,105 @@ asserts: has_text: text: "MultiQC" + +- doc: Test outline for adna-analysis.ga (Paired-End) + job: + Choose Read Type: Paired-End + Input Paired-end Forward reads (R1): + class: Collection + collection_type: list + elements: + - class: File + identifier: NIST7035 + location: https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz + filetype: fastqsanger.gz + Input Paired-end reverse reads (R2): + class: Collection + collection_type: list + elements: + - class: File + identifier: NIST7035 + location: https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R2_001_10MB.fastq.gz + filetype: fastqsanger.gz + Reference genome: + class: File + location: https://github.com/nf-core/test-datasets/raw/eager/reference/Human/hs37d5_chr21-MT.fa.gz + filetype: fasta.gz + Hap Map ChrX reference: + class: File + location: https://github.com/ANGSD/angsd/raw/master/RES/HapMapChrX.gz + filetype: gz + Choose Mapper: BWA + Optional BED file for Sex.DetERRmine: null + Kraken2 database directory: viral2019-03 + outputs: + Fully post-processed mapping results: + asserts: + has_size: + min: 100 + EndorSpy endogenous DNA authentication report: + asserts: + has_text: + text: "percent_on_target" + Sex.DetERRmine (Without BED) report of chromosomal gender estimation: + asserts: + has_text: + text: "Sex.DetERRmine" + QualiMap BamQC general alignment quality metrics report: + asserts: + has_text: + text: "Qualimap Report: BAM QC" + Mitochondrial to nuclear DNA ratio calculation report: + asserts: + has_text: + text: "mtnuccalculator" + mapDamage Visualisation: + element_tests: + dnacomp: + asserts: + has_text: + text: "mapDamage" + misincorporation: + asserts: + has_text: + text: "mapDamage" + 5pCtoT_freq: + asserts: + has_text: + text: "5pC>T" + 3pGtoA_freq: + asserts: + has_text: + text: "3pG>A" + Fragmisincorporation_plot: + asserts: + has_size: + min: 100 + lgdistribution: + asserts: + has_text: + text: "mapDamage" + Length_plot: + asserts: + has_size: + min: 100 + Freebayes raw genomic variant calls: + asserts: + has_text: + text: "freeBayes" + ANGSD report of nuclear contamination estimation: + asserts: + has_text: + text: "Method1_MOM_estimate" + Bcftools variant calling summary statistics report: + asserts: + has_text: + text: "ACT>TCGA" + Kraken2 taxonomic classification and microbial screening report: + asserts: + has_text: + text: "root" + MultiQC aggregated workflow summary report: + asserts: + has_text: + text: "MultiQC" \ No newline at end of file From 0283eda267d6f5a001969495ceda43f8c8db3fc0 Mon Sep 17 00:00:00 2001 From: Ubuntu Date: Mon, 6 Jul 2026 19:19:53 +0000 Subject: [PATCH 11/17] fix: align workflow readme, add format constraints to PE inputs, and clean up naming consistency --- .../paleogenomics/adna-analysis/README.md | 8 ++-- .../adna-analysis/adna-analysis-tests.yml | 26 +++++------ .../adna-analysis/adna-analysis.ga | 43 ++++++++----------- 3 files changed, 34 insertions(+), 43 deletions(-) diff --git a/workflows/paleogenomics/adna-analysis/README.md b/workflows/paleogenomics/adna-analysis/README.md index a413c99ee5..df53610a4c 100644 --- a/workflows/paleogenomics/adna-analysis/README.md +++ b/workflows/paleogenomics/adna-analysis/README.md @@ -13,11 +13,11 @@ To run this workflow successfully, you need to provide the following input datas * **`Input Paired-end reverse reads (R2)` :** Input paired-end reverse FASTQ reads (list collection) for the sample. * **`Reference genome` :** Reference genome sequence in FASTA format. This is essential for read mapping and variant calling. * **`Choose Mapper` :** Switch to select the alignment tool. Choose between BWA and Bowtie2. -* **`Hap Map ChrX reference` :** HapMap dataset required for X-chromosome contamination estimation in ANGSD. +* **`HapMap chromosome X reference` :** Optional HapMap dataset used for X-chromosome contamination estimation in ANGSD (used only if provided). * **`Input Mitochondrial Chromosome Name` :** The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS). * **`Kraken2 database directory` :** The database directory required for Kraken2 taxonomic classification. * **`Optional BED file for Sex.DetERRmine` :** An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms. -* **`ANGSD region parameter` :** The specific genomic region to restrict the ANGSD analysis (typically 'X' for human male nuclear contamination estimation). +* **`ANGSD region parameter` :** The specific genomic region to restrict the ANGSD analysis (e.g. 'X:5000000-154900000' for human male nuclear contamination estimation; adjust for your reference). ## Workflow Steps @@ -70,13 +70,13 @@ Upon successful execution, the workflow explicitly provides the following final * **`ANGSD report of nuclear contamination estimation` :** A tabular text file detailing the estimates of nuclear X-chromosome contamination. * **`Bcftools variant calling summary statistics report` :** A text file containing comprehensive summary statistics for the called variants (VCF). * **`Fully post-processed mapping results` :** The final deduplicated and filtered alignment BAM file. -* **`Freebayes raw genomic variant calls` :** The raw VCF file generated from variant analysis. +* **`FreeBayes raw genomic variant calls` :** The raw VCF file generated from variant analysis. ## Testing Data To ensure the workflow functions correctly, it was validated using the following datasets and databases: -* **`Primary Test Data` :** A downsampled single-end FASTQ dataset [NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz](https://zenodo.org/records/20271974/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz) optimized for rapid workflow testing and validation. +* **`Primary Test Data` :** A downsampled paired-end FASTQ dataset [NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz](https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz) and [NIST7035_TAAGGCGA_L001_R2_001_10MB.fastq.gz](https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R2_001_10MB.fastq.gz) optimized for rapid workflow testing and validation. * **`Primary Reference Genome` :** The [hs37d5_chr21-MT.fa.gz](https://github.com/nf-core/test-datasets/blob/eager/reference/Human/hs37d5_chr21-MT.fa.gz) file was utilized as the primary reference genome sequence. * **`X-Chromosome Contamination Reference` :** The [HapMap ChrX](https://github.com/ANGSD/angsd/blob/master/RES/HapMapChrX.gz) dataset was provided as the initial reference for the estimation of X-chromosome contamination using the ANGSD tool. * **`Taxonomic Classification Database` :** The Minikraken v2 database was utilized to perform taxonomic classification via Kraken2. \ No newline at end of file diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml index c54bc1b797..09866f0445 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml +++ b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml @@ -1,4 +1,4 @@ -- doc: Test outline for adna-analysis.ga (Single-End) +- doc: Test outline for adna-analysis.ga (Single-End, BWA, No BED, HapMap Present) job: Choose Read Type: Single-End Input Single-end reads: @@ -13,7 +13,7 @@ class: File location: https://github.com/nf-core/test-datasets/raw/eager/reference/Human/hs37d5_chr21-MT.fa.gz filetype: fasta.gz - Hap Map ChrX reference: + HapMap chromosome X reference: class: File location: https://github.com/ANGSD/angsd/raw/master/RES/HapMapChrX.gz filetype: gz @@ -71,7 +71,7 @@ asserts: has_size: min: 100 - Freebayes raw genomic variant calls: + FreeBayes raw genomic variant calls: asserts: has_text: text: "freeBayes" @@ -92,7 +92,7 @@ has_text: text: "MultiQC" -- doc: Test outline for adna-analysis.ga (Paired-End) +- doc: Test outline for adna-analysis.ga (Paired-End, Bowtie2, BED Present, No HapMap) job: Choose Read Type: Paired-End Input Paired-end Forward reads (R1): @@ -115,12 +115,12 @@ class: File location: https://github.com/nf-core/test-datasets/raw/eager/reference/Human/hs37d5_chr21-MT.fa.gz filetype: fasta.gz - Hap Map ChrX reference: + HapMap chromosome X reference: null + Choose Mapper: Bowtie2 + Optional BED file for Sex.DetERRmine: class: File - location: https://github.com/ANGSD/angsd/raw/master/RES/HapMapChrX.gz - filetype: gz - Choose Mapper: BWA - Optional BED file for Sex.DetERRmine: null + location: https://github.com/nf-core/test-datasets/raw/eager/reference/Human/1240K.pos.list_hs37d5.0based.bed.gz + filetype: bed.gz Kraken2 database directory: viral2019-03 outputs: Fully post-processed mapping results: @@ -131,7 +131,7 @@ asserts: has_text: text: "percent_on_target" - Sex.DetERRmine (Without BED) report of chromosomal gender estimation: + Sex.DetERRmine (With BED) report of chromosomal gender estimation: asserts: has_text: text: "Sex.DetERRmine" @@ -173,14 +173,10 @@ asserts: has_size: min: 100 - Freebayes raw genomic variant calls: + FreeBayes raw genomic variant calls: asserts: has_text: text: "freeBayes" - ANGSD report of nuclear contamination estimation: - asserts: - has_text: - text: "Method1_MOM_estimate" Bcftools variant calling summary statistics report: asserts: has_text: diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis.ga b/workflows/paleogenomics/adna-analysis/adna-analysis.ga index 397cd4ac41..e89d090c5f 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis.ga +++ b/workflows/paleogenomics/adna-analysis/adna-analysis.ga @@ -13,7 +13,7 @@ "license": "MIT", "release": "0.1", "name": "Ancient DNA analysis", - "readme": "# Pipeline Summary\nThis workflow performs an ancient DNA (aDNA) based analysis similar to the one in the [nf-core/eager](https://nf-co.re/eager/2.5.3/) workflow. nf-core/eager is a bioinformatics best-practice processing pipeline for genomic NGS sequencing data, with a focus on ancient DNA data. It is ideal for the (palaeo)genomic analysis of humans, animals, plants, microbes and even microbiomes.\n\nThe pipeline processes the sequencing-read input provided to the workflow together with a reference genome and optional supporting reference data. It aligns reads and performs extensive general NGS and aDNA-specific quality control on the results.\n\n\n## Required & Optional Inputs\nTo run this workflow successfully, you need to provide the following input datasets and parameters:\n\n\n* **`Input reads` :** Input single-end FASTQ reads for the sample.\n* **`Reference genome` :** Reference genome sequence in FASTA format. This is essential for read mapping and variant calling.\n* **`Choose Mapper` :** Switch to select the alignment tool. Choose between BWA and Bowtie2.\n* **`Hap Map ChrX reference` :** HapMap dataset required for X-chromosome contamination estimation in ANGSD.\n* **`Input Mitochondrial Chromosome Name` :** The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS).\n* **`Kraken2 database directory` :** The database directory required for Kraken2 taxonomic classification.\n* **`Optional BED file for Sex.DetERRmine` :** An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms.\n* **`ANGSD region parameter` :** The specific genomic region to restrict the ANGSD analysis (typically 'X' for human male nuclear contamination estimation).\n\n\n## Workflow Steps\nBy default the pipeline currently performs the following:\n\n## 1. Preprocessing and Quality Control\n* **Quality Control:** Evaluates read quality before and after trimming (`FastQC`)\n* **Adapter Trimming:** Removes adapter sequences (`AdapterRemoval`)\n\n## 2. Read Mapping and Processing\n* **Alignment:** Maps reads to the provided reference genome conditionally using either (`BWA`) or (`Bowtie2`) based on user selection\n* **Filtering and Statistics:** Separates unmapped reads and calculates alignment statistics (`Samtools View and Flagstat`)\n* **Duplicate Removal:** Detects and marks PCR duplicates (`Picard MarkDuplicates`)\n* **Alignment Quality:** Generates detailed BAM quality metrics (`QualiMap BamQC`)\n* **Library Complexity:** Estimates library complexity (`Preseq`)\n\n## 3. Ancient DNA (aDNA) Analysis\n* **Damage Profiling:** Visualizes aDNA-specific C-to-T damage patterns (`mapDamage`)\n* **Endogenous Content:** Calculates the proportion of endogenous (target) DNA in the sample (`EndorSpy`)\n* **(`Optional`) Contamination:** Estimates nuclear X-chromosome contamination conditionally if HapMap data is provided (`ANGSD X-Contamination`)\n\n## 4. Biological Information\n* **Sex Determination:** Determines biological sex based on relative chromosome coverage ratio. This step adapts conditionally whether an optional BED file is provided (`Sex.DetERRmine`)\n* **Mt/Nuc Ratio:** Calculates the ratio of mitochondrial reads to nuclear reads utilizing the specified mitochondrial chromosome name (`MtNucRatioCalculator`)\n\n## 5. Genotyping\n* **Variant Analysis:** Performs variant calling to generate VCF files (`FreeBayes`)\n* **Variant Statistics:** Calculates statistics for the generated variants (`Bcftools stats`)\n\n## 6. Metagenomic Screening (For Unmapped Reads)\n* **Read Extraction:** Extracts unmapped reads for microbial analysis (`Picard SamToFastq`)\n* **Quality Filter:** Filters low-complexity sequences (`BBTools BBduk`)\n* **Taxonomic Classification:** Performs microbiome/taxonomic screening on the filtered unmapped reads (`Kraken2`)\n\n## 7. Reporting\n* **Summary Report:** Aggregates logs and statistics from all these tools into a single interactive HTML report (`MultiQC`)\n\n\n## Workflow Outputs\nUpon successful execution, the workflow explicitly provides the following final files for analysis:\n\n* **`MultiQC aggregated workflow summary report` :** An interactive HTML report aggregating QC and analysis logs from all tools.\n* **`QualiMap BamQC general alignment quality metrics report` :** A detailed HTML report containing mapping quality metrics, GC content, and coverage statistics.\n* **`mapDamage Visualisation` :** Visual plots displaying the characteristic C-to-T deamination patterns at the ends of ancient DNA reads.\n* **`Kraken2 taxonomic classification and microbial screening report` :** A tabular report showing the taxonomic classification of unmapped reads.\n* **`EndorSpy endogenous DNA authentication report` :** A JSON file containing the calculated endogenous DNA percentage.\n* **`Sex.DetERRmine (Without BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for human-genome alignments.\n* **`Sex.DetERRmine (With BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for targeted capture regions.\n* **`Mitochondrial to nuclear DNA ratio calculation report` :** A JSON file containing the calculated ratio between mitochondrial and nuclear reads.\n* **`ANGSD report of nuclear contamination estimation` :** A tabular text file detailing the estimates of nuclear X-chromosome contamination.\n* **`Bcftools variant calling summary statistics report` :** A text file containing comprehensive summary statistics for the called variants (VCF).\n* **`Fully post-processed mapping results` :** The final deduplicated and filtered alignment BAM file.\n* **`Freebayes raw genomic variant calls` :** The raw VCF file generated from variant analysis.\n\n\n## Testing Data\nTo ensure the workflow functions correctly, it was validated using the following datasets and databases:\n\n* **`Primary Test Data` :** A downsampled single-end FASTQ dataset (`NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz`) optimized for rapid workflow testing and validation.\n* **`Primary Reference Genome` :** The [hs37d5_chr21-MT.fa.gz](https://github.com/nf-core/test-datasets/blob/eager/reference/Human/hs37d5_chr21-MT.fa.gz) file was utilized as the primary reference genome sequence.\n* **`X-Chromosome Contamination Reference` :** The [HapMap ChrX](https://github.com/ANGSD/angsd/blob/master/RES/HapMapChrX.gz) dataset was provided as the initial reference for the estimation of X-chromosome contamination using the ANGSD tool.\n* **`Taxonomic Classification Database` :** The Minikraken v2 database was utilized to perform taxonomic classification via Kraken2.", + "readme": "# Ancient DNA analysis pipeline\nThis workflow performs an ancient DNA (aDNA) based analysis similar to the one in the [nf-core/eager](https://nf-co.re/eager/2.5.3/) workflow. nf-core/eager is a bioinformatics best-practice processing pipeline for genomic NGS sequencing data, with a focus on ancient DNA data. It is ideal for the (palaeo)genomic analysis of humans, animals, plants, microbes and even microbiomes.\n\nThe pipeline processes the sequencing-read input provided to the workflow together with a reference genome and optional supporting reference data. It aligns reads and performs extensive general NGS and aDNA-specific quality control on the results.\n\n\n## Required & Optional Inputs\nTo run this workflow successfully, you need to provide the following input datasets and parameters:\n\n* **`Choose Read Type` :** Select whether your input is Single-End or Paired-End.\n* **`Input Single-end reads` :** Input single-end FASTQ reads (list collection) for the sample.\n* **`Input Paired-end Forward reads (R1)` :** Input paired-end forward FASTQ reads (list collection) for the sample.\n* **`Input Paired-end reverse reads (R2)` :** Input paired-end reverse FASTQ reads (list collection) for the sample.\n* **`Reference genome` :** Reference genome sequence in FASTA format. This is essential for read mapping and variant calling.\n* **`Choose Mapper` :** Switch to select the alignment tool. Choose between BWA and Bowtie2.\n* **`HapMap chromosome X reference` :** Optional HapMap dataset used for X-chromosome contamination estimation in ANGSD (used only if provided).\n* **`Input Mitochondrial Chromosome Name` :** The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS).\n* **`Kraken2 database directory` :** The database directory required for Kraken2 taxonomic classification.\n* **`Optional BED file for Sex.DetERRmine` :** An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms.\n* **`ANGSD region parameter` :** The specific genomic region to restrict the ANGSD analysis (e.g. 'X:5000000-154900000' for human male nuclear contamination estimation; adjust for your reference).\n\n\n## Workflow Steps\nBy default the pipeline currently performs the following:\n\n## 1. Preprocessing and Quality Control\n* **Quality Control:** Evaluates read quality before and after trimming (`FastQC`)\n* **Adapter Trimming:** Removes adapter sequences (`AdapterRemoval`)\n\n## 2. Read Mapping and Processing\n* **Alignment:** Maps reads to the provided reference genome conditionally using either (`BWA`) or (`Bowtie2`) based on user selection\n* **Filtering and Statistics:** Separates unmapped reads and calculates alignment statistics (`Samtools View and Flagstat`)\n* **Duplicate Removal:** Detects and marks PCR duplicates (`Picard MarkDuplicates`)\n* **Alignment Quality:** Generates detailed BAM quality metrics (`QualiMap BamQC`)\n* **Library Complexity:** Estimates library complexity (`Preseq`)\n\n## 3. Ancient DNA (aDNA) Analysis\n* **Damage Profiling:** Visualizes aDNA-specific C-to-T damage patterns (`mapDamage`)\n* **Endogenous Content:** Calculates the proportion of endogenous (target) DNA in the sample (`EndorSpy`)\n* **(`Optional`) Contamination:** Estimates nuclear X-chromosome contamination conditionally if HapMap data is provided (`ANGSD X-Contamination`)\n\n## 4. Biological Information\n* **Sex Determination:** Determines biological sex based on relative chromosome coverage ratio. This step adapts conditionally whether an optional BED file is provided (`Sex.DetERRmine`)\n* **Mt/Nuc Ratio:** Calculates the ratio of mitochondrial reads to nuclear reads utilizing the specified mitochondrial chromosome name (`MtNucRatioCalculator`)\n\n## 5. Genotyping\n* **Variant Analysis:** Performs variant calling to generate VCF files (`FreeBayes`)\n* **Variant Statistics:** Calculates statistics for the generated variants (`Bcftools stats`)\n\n## 6. Metagenomic Screening (For Unmapped Reads)\n* **Read Extraction:** Extracts unmapped reads for microbial analysis (`Picard SamToFastq`)\n* **Quality Filter:** Filters low-complexity sequences (`BBTools BBduk`)\n* **Taxonomic Classification:** Performs microbiome/taxonomic screening on the filtered unmapped reads (`Kraken2`)\n\n## 7. Reporting\n* **Summary Report:** Aggregates logs and statistics from all these tools into a single interactive HTML report (`MultiQC`)\n\n\n## Workflow Outputs\nUpon successful execution, the workflow explicitly provides the following final files for analysis:\n\n* **`MultiQC aggregated workflow summary report` :** An interactive HTML report aggregating QC and analysis logs from all tools.\n* **`QualiMap BamQC general alignment quality metrics report` :** A detailed HTML report containing mapping quality metrics, GC content, and coverage statistics.\n* **`mapDamage Visualisation` :** Visual plots displaying the characteristic C-to-T deamination patterns at the ends of ancient DNA reads.\n* **`Kraken2 taxonomic classification and microbial screening report` :** A tabular report showing the taxonomic classification of unmapped reads.\n* **`EndorSpy endogenous DNA authentication report` :** A JSON file containing the calculated endogenous DNA percentage.\n* **`Sex.DetERRmine (Without BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for human-genome alignments.\n* **`Sex.DetERRmine (With BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for targeted capture regions.\n* **`Mitochondrial to nuclear DNA ratio calculation report` :** A JSON file containing the calculated ratio between mitochondrial and nuclear reads.\n* **`ANGSD report of nuclear contamination estimation` :** A tabular text file detailing the estimates of nuclear X-chromosome contamination.\n* **`Bcftools variant calling summary statistics report` :** A text file containing comprehensive summary statistics for the called variants (VCF).\n* **`Fully post-processed mapping results` :** The final deduplicated and filtered alignment BAM file.\n* **`FreeBayes raw genomic variant calls` :** The raw VCF file generated from variant analysis.\n\n\n## Testing Data\nTo ensure the workflow functions correctly, it was validated using the following datasets and databases:\n\n* **`Primary Test Data` :** A downsampled paired-end FASTQ dataset [NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz](https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz) and [NIST7035_TAAGGCGA_L001_R2_001_10MB.fastq.gz](https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R2_001_10MB.fastq.gz) optimized for rapid workflow testing and validation.\n* **`Primary Reference Genome` :** The [hs37d5_chr21-MT.fa.gz](https://github.com/nf-core/test-datasets/blob/eager/reference/Human/hs37d5_chr21-MT.fa.gz) file was utilized as the primary reference genome sequence.\n* **`X-Chromosome Contamination Reference` :** The [HapMap ChrX](https://github.com/ANGSD/angsd/blob/master/RES/HapMapChrX.gz) dataset was provided as the initial reference for the estimation of X-chromosome contamination using the ANGSD tool.\n* **`Taxonomic Classification Database` :** The Minikraken v2 database was utilized to perform taxonomic classification via Kraken2.", "report": { "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" }, @@ -92,7 +92,7 @@ "top": 791.502398805326 }, "tool_id": null, - "tool_state": "{\"optional\": true, \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", + "tool_state": "{\"optional\": true, \"format\": [\"fastq.gz\", \"fastqsanger.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", "tool_version": null, "type": "data_collection_input", "uuid": "182acaba-5521-4972-9d17-c51a485160f9", @@ -115,11 +115,11 @@ "name": "Input dataset collection", "outputs": [], "position": { - "left": 0.0, + "left": 0, "top": 909.1024659439979 }, "tool_id": null, - "tool_state": "{\"optional\": true, \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", + "tool_state": "{\"optional\": true, \"format\": [\"fastq.gz\", \"fastqsanger.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", "tool_version": null, "type": "data_collection_input", "uuid": "8bc74801-26a1-4ea3-90a4-46ba6d8ee2eb", @@ -243,10 +243,10 @@ "inputs": [ { "description": "HapMap dataset required for X-chromosome contamination estimation in ANGSD.", - "name": "Hap Map ChrX reference" + "name": "HapMap chromosome X reference" } ], - "label": "Hap Map ChrX reference", + "label": "HapMap chromosome X reference", "name": "Input dataset", "outputs": [], "position": { @@ -674,7 +674,7 @@ "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", "tool_shed_repository": { - "changeset_revision": "40874f772ea1", + "changeset_revision": "ff174ae7a02f", "name": "adapter_removal", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -730,7 +730,7 @@ ], "position": { "left": 1585.0605375620003, - "top": 0.0 + "top": 0 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", @@ -808,7 +808,7 @@ "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", "tool_shed_repository": { - "changeset_revision": "40874f772ea1", + "changeset_revision": "ff174ae7a02f", "name": "adapter_removal", "owner": "iuc", "tool_shed": "toolshed.g2.bx.psu.edu" @@ -966,12 +966,7 @@ "output_name": "output_param_boolean" } }, - "inputs": [ - { - "description": "runtime parameter for tool Concatenate multiple datasets or collections", - "name": "input1" - } - ], + "inputs": [], "label": null, "name": "Concatenate multiple datasets or collections", "outputs": [ @@ -986,7 +981,7 @@ }, "post_job_actions": {}, "tool_id": "cat1", - "tool_state": "{\"input1\": {\"__class__\": \"RuntimeValue\"}, \"queries\": [{\"__index__\": 0, \"input2\": {\"__class__\": \"RuntimeValue\"}}, {\"__index__\": 1, \"input2\": {\"__class__\": \"RuntimeValue\"}}], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [{\"__index__\": 0, \"input2\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"input2\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", "tool_uuid": null, "tool_version": "1.0.0", "type": "tool", @@ -2068,8 +2063,8 @@ } ], "position": { - "left": 3796.690788825225, - "top": 2691.3442286752565 + "left": 3797.7429031173497, + "top": 2711.3938670695097 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/freebayes/freebayes/1.3.10+galaxy1", @@ -2087,9 +2082,9 @@ "when": null, "workflow_outputs": [ { - "label": "Freebayes raw genomic variant calls", + "label": "FreeBayes raw genomic variant calls", "output_name": "output_vcf", - "uuid": "947ea898-b15a-4942-8caa-ae6efeb59c66" + "uuid": "2ee04238-e4fd-47a6-aa9c-50a999e7d67a" } ] }, @@ -2119,8 +2114,8 @@ } ], "position": { - "left": 3796.565701585027, - "top": 2192.2937632681387 + "left": 3796.5623204474264, + "top": 2196.5097635888333 }, "post_job_actions": {}, "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bbtools_bbduk/bbtools_bbduk/39.08+galaxy4", @@ -2463,6 +2458,6 @@ } }, "tags": [], - "uuid": "d0dae49f-bcad-44c6-9ac9-f2d047290da7", - "version": 8 + "uuid": "ab793987-07cf-42f4-b819-96720aefed33", + "version": 4 } \ No newline at end of file From 1487051d512b1a8acaadacdeeaea1f6feb7fdf31 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Mert=20Ayd=C4=B1n?= <56894545+mertydn@users.noreply.github.com> Date: Mon, 6 Jul 2026 23:04:58 +0200 Subject: [PATCH 12/17] Change BED file type from bed.gz to bed --- workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml index 09866f0445..19d3755db4 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml +++ b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml @@ -120,7 +120,7 @@ Optional BED file for Sex.DetERRmine: class: File location: https://github.com/nf-core/test-datasets/raw/eager/reference/Human/1240K.pos.list_hs37d5.0based.bed.gz - filetype: bed.gz + filetype: bed Kraken2 database directory: viral2019-03 outputs: Fully post-processed mapping results: @@ -188,4 +188,4 @@ MultiQC aggregated workflow summary report: asserts: has_text: - text: "MultiQC" \ No newline at end of file + text: "MultiQC" From fbdf694ff18341b744a062c72d7f7f5865311b4b Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Mert=20Ayd=C4=B1n?= <56894545+mertydn@users.noreply.github.com> Date: Tue, 7 Jul 2026 00:38:43 +0200 Subject: [PATCH 13/17] Update identifiers and file types in adna-analysis-tests.yml --- .../paleogenomics/adna-analysis/adna-analysis-tests.yml | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml index 19d3755db4..19ca390004 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml +++ b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml @@ -100,7 +100,7 @@ collection_type: list elements: - class: File - identifier: NIST7035 + identifier: NIST7035_R1 location: https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz filetype: fastqsanger.gz Input Paired-end reverse reads (R2): @@ -108,7 +108,7 @@ collection_type: list elements: - class: File - identifier: NIST7035 + identifier: NIST7035_R2 location: https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R2_001_10MB.fastq.gz filetype: fastqsanger.gz Reference genome: @@ -120,7 +120,7 @@ Optional BED file for Sex.DetERRmine: class: File location: https://github.com/nf-core/test-datasets/raw/eager/reference/Human/1240K.pos.list_hs37d5.0based.bed.gz - filetype: bed + filetype: tabular Kraken2 database directory: viral2019-03 outputs: Fully post-processed mapping results: From 5806c2340b8743ff75e1941507cf2a491809db9f Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Mert=20Ayd=C4=B1n?= <56894545+mertydn@users.noreply.github.com> Date: Tue, 7 Jul 2026 02:06:09 +0200 Subject: [PATCH 14/17] Refactor output assertions for adna-analysis tests Refactored output assertions to use element_tests for NIST7035 and updated text assertions for various reports. --- .../adna-analysis/adna-analysis-tests.yml | 188 +++++++++--------- 1 file changed, 89 insertions(+), 99 deletions(-) diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml index 19ca390004..2025c2e8f5 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml +++ b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml @@ -22,75 +22,71 @@ Kraken2 database directory: viral2019-03 outputs: Fully post-processed mapping results: - asserts: - has_size: - min: 100 + element_tests: + NIST7035: + asserts: + has_size: + min: 100 EndorSpy endogenous DNA authentication report: - asserts: - has_text: - text: "percent_on_target" - Sex.DetERRmine (Without BED) report of chromosomal gender estimation: - asserts: - has_text: - text: "Sex.DetERRmine" - QualiMap BamQC general alignment quality metrics report: - asserts: - has_text: - text: "Qualimap Report: BAM QC" - Mitochondrial to nuclear DNA ratio calculation report: - asserts: - has_text: - text: "mtnuccalculator" - mapDamage Visualisation: element_tests: - dnacomp: + NIST7035: asserts: has_text: - text: "mapDamage" - misincorporation: + text: "percent_on_target" + Sex.DetERRmine (Without BED) report of chromosomal gender estimation: + element_tests: + NIST7035: asserts: has_text: - text: "mapDamage" - 5pCtoT_freq: + text: "Sex.DetERRmine" + QualiMap BamQC general alignment quality metrics report: + element_tests: + NIST7035: asserts: has_text: - text: "5pC>T" - 3pGtoA_freq: + text: "Qualimap Report: BAM QC" + Mitochondrial to nuclear DNA ratio calculation report: + element_tests: + NIST7035: asserts: has_text: - text: "3pG>A" - Fragmisincorporation_plot: + text: "mtnuccalculator" + mapDamage Visualisation: + element_tests: + NIST7035: asserts: has_size: min: 100 - lgdistribution: + FreeBayes raw genomic variant calls: + element_tests: + NIST7035: asserts: has_text: - text: "mapDamage" - Length_plot: - asserts: - has_size: - min: 100 - FreeBayes raw genomic variant calls: - asserts: - has_text: - text: "freeBayes" + text: "freeBayes" ANGSD report of nuclear contamination estimation: - asserts: - has_text: - text: "Method1_MOM_estimate" + element_tests: + NIST7035: + asserts: + has_text: + text: "Method1_MOM_estimate" Bcftools variant calling summary statistics report: - asserts: - has_text: - text: "ACT>TCGA" + element_tests: + NIST7035: + asserts: + has_text: + text: "ACT>TCGA" Kraken2 taxonomic classification and microbial screening report: - asserts: - has_text: - text: "root" + element_tests: + NIST7035: + asserts: + has_text: + text: "root" MultiQC aggregated workflow summary report: - asserts: - has_text: - text: "MultiQC" + element_tests: + NIST7035: + asserts: + has_text: + text: "MultiQC" - doc: Test outline for adna-analysis.ga (Paired-End, Bowtie2, BED Present, No HapMap) job: @@ -100,7 +96,7 @@ collection_type: list elements: - class: File - identifier: NIST7035_R1 + identifier: NIST7035 location: https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz filetype: fastqsanger.gz Input Paired-end reverse reads (R2): @@ -108,7 +104,7 @@ collection_type: list elements: - class: File - identifier: NIST7035_R2 + identifier: NIST7035 location: https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R2_001_10MB.fastq.gz filetype: fastqsanger.gz Reference genome: @@ -124,68 +120,62 @@ Kraken2 database directory: viral2019-03 outputs: Fully post-processed mapping results: - asserts: - has_size: - min: 100 + element_tests: + NIST7035: + asserts: + has_size: + min: 100 EndorSpy endogenous DNA authentication report: - asserts: - has_text: - text: "percent_on_target" - Sex.DetERRmine (With BED) report of chromosomal gender estimation: - asserts: - has_text: - text: "Sex.DetERRmine" - QualiMap BamQC general alignment quality metrics report: - asserts: - has_text: - text: "Qualimap Report: BAM QC" - Mitochondrial to nuclear DNA ratio calculation report: - asserts: - has_text: - text: "mtnuccalculator" - mapDamage Visualisation: element_tests: - dnacomp: + NIST7035: asserts: has_text: - text: "mapDamage" - misincorporation: + text: "percent_on_target" + Sex.DetERRmine (With BED) report of chromosomal gender estimation: + element_tests: + NIST7035: asserts: has_text: - text: "mapDamage" - 5pCtoT_freq: + text: "Sex.DetERRmine" + QualiMap BamQC general alignment quality metrics report: + element_tests: + NIST7035: asserts: has_text: - text: "5pC>T" - 3pGtoA_freq: + text: "Qualimap Report: BAM QC" + Mitochondrial to nuclear DNA ratio calculation report: + element_tests: + NIST7035: asserts: has_text: - text: "3pG>A" - Fragmisincorporation_plot: + text: "mtnuccalculator" + mapDamage Visualisation: + element_tests: + NIST7035: asserts: has_size: min: 100 - lgdistribution: + FreeBayes raw genomic variant calls: + element_tests: + NIST7035: asserts: has_text: - text: "mapDamage" - Length_plot: - asserts: - has_size: - min: 100 - FreeBayes raw genomic variant calls: - asserts: - has_text: - text: "freeBayes" + text: "freeBayes" Bcftools variant calling summary statistics report: - asserts: - has_text: - text: "ACT>TCGA" + element_tests: + NIST7035: + asserts: + has_text: + text: "ACT>TCGA" Kraken2 taxonomic classification and microbial screening report: - asserts: - has_text: - text: "root" + element_tests: + NIST7035: + asserts: + has_text: + text: "root" MultiQC aggregated workflow summary report: - asserts: - has_text: - text: "MultiQC" + element_tests: + NIST7035: + asserts: + has_text: + text: "MultiQC" From 3ec061e8e16754a018abce3c64f62b1407a7b0a1 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Mert=20Ayd=C4=B1n?= <56894545+mertydn@users.noreply.github.com> Date: Tue, 7 Jul 2026 03:03:53 +0200 Subject: [PATCH 15/17] Refactor MultiQC test assertions in YAML workflow --- .../adna-analysis/adna-analysis-tests.yml | 16 ++++++---------- 1 file changed, 6 insertions(+), 10 deletions(-) diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml index 2025c2e8f5..d4604c1544 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml +++ b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml @@ -82,11 +82,9 @@ has_text: text: "root" MultiQC aggregated workflow summary report: - element_tests: - NIST7035: - asserts: - has_text: - text: "MultiQC" + asserts: + has_text: + text: "MultiQC" - doc: Test outline for adna-analysis.ga (Paired-End, Bowtie2, BED Present, No HapMap) job: @@ -174,8 +172,6 @@ has_text: text: "root" MultiQC aggregated workflow summary report: - element_tests: - NIST7035: - asserts: - has_text: - text: "MultiQC" + asserts: + has_text: + text: "MultiQC" From f43e8c2b56e214517ca8cbc00a012310e6cf4ac1 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Mert=20Ayd=C4=B1n?= <56894545+mertydn@users.noreply.github.com> Date: Tue, 7 Jul 2026 11:28:52 +0200 Subject: [PATCH 16/17] Refactor report tests to simplify structure --- .../adna-analysis/adna-analysis-tests.yml | 32 +++++++------------ 1 file changed, 12 insertions(+), 20 deletions(-) diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml index d4604c1544..84f496512f 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml +++ b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml @@ -28,17 +28,13 @@ has_size: min: 100 EndorSpy endogenous DNA authentication report: - element_tests: - NIST7035: - asserts: - has_text: - text: "percent_on_target" + asserts: + has_text: + text: "percent_on_target" Sex.DetERRmine (Without BED) report of chromosomal gender estimation: - element_tests: - NIST7035: - asserts: - has_text: - text: "Sex.DetERRmine" + asserts: + has_text: + text: "Sex.DetERRmine" QualiMap BamQC general alignment quality metrics report: element_tests: NIST7035: @@ -124,17 +120,13 @@ has_size: min: 100 EndorSpy endogenous DNA authentication report: - element_tests: - NIST7035: - asserts: - has_text: - text: "percent_on_target" + asserts: + has_text: + text: "percent_on_target" Sex.DetERRmine (With BED) report of chromosomal gender estimation: - element_tests: - NIST7035: - asserts: - has_text: - text: "Sex.DetERRmine" + asserts: + has_text: + text: "Sex.DetERRmine" QualiMap BamQC general alignment quality metrics report: element_tests: NIST7035: From f4cb4280a4a0d203e2938825be22647a067a236f Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Mert=20Ayd=C4=B1n?= <56894545+mertydn@users.noreply.github.com> Date: Tue, 7 Jul 2026 15:49:20 +0200 Subject: [PATCH 17/17] Refactor assertions to use element_tests structure --- .../adna-analysis/adna-analysis-tests.yml | 64 ++++++++++++------- 1 file changed, 40 insertions(+), 24 deletions(-) diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml index 84f496512f..09d85de465 100644 --- a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml +++ b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml @@ -28,13 +28,17 @@ has_size: min: 100 EndorSpy endogenous DNA authentication report: - asserts: - has_text: - text: "percent_on_target" + element_tests: + NIST7035: + asserts: + has_text: + text: "percent_on_target" Sex.DetERRmine (Without BED) report of chromosomal gender estimation: - asserts: - has_text: - text: "Sex.DetERRmine" + element_tests: + NIST7035: + asserts: + has_text: + text: "Sex.DetERRmine" QualiMap BamQC general alignment quality metrics report: element_tests: NIST7035: @@ -50,9 +54,11 @@ mapDamage Visualisation: element_tests: NIST7035: - asserts: - has_size: - min: 100 + element_tests: + dnacomp: + asserts: + has_text: + text: "mapDamage" FreeBayes raw genomic variant calls: element_tests: NIST7035: @@ -78,9 +84,11 @@ has_text: text: "root" MultiQC aggregated workflow summary report: - asserts: - has_text: - text: "MultiQC" + element_tests: + NIST7035: + asserts: + has_text: + text: "MultiQC" - doc: Test outline for adna-analysis.ga (Paired-End, Bowtie2, BED Present, No HapMap) job: @@ -120,13 +128,17 @@ has_size: min: 100 EndorSpy endogenous DNA authentication report: - asserts: - has_text: - text: "percent_on_target" + element_tests: + NIST7035: + asserts: + has_text: + text: "percent_on_target" Sex.DetERRmine (With BED) report of chromosomal gender estimation: - asserts: - has_text: - text: "Sex.DetERRmine" + element_tests: + NIST7035: + asserts: + has_text: + text: "Sex.DetERRmine" QualiMap BamQC general alignment quality metrics report: element_tests: NIST7035: @@ -142,9 +154,11 @@ mapDamage Visualisation: element_tests: NIST7035: - asserts: - has_size: - min: 100 + element_tests: + dnacomp: + asserts: + has_text: + text: "mapDamage" FreeBayes raw genomic variant calls: element_tests: NIST7035: @@ -164,6 +178,8 @@ has_text: text: "root" MultiQC aggregated workflow summary report: - asserts: - has_text: - text: "MultiQC" + element_tests: + NIST7035: + asserts: + has_text: + text: "MultiQC"