diff --git a/workflows/paleogenomics/adna-analysis/.dockstore.yml b/workflows/paleogenomics/adna-analysis/.dockstore.yml new file mode 100644 index 0000000000..e8c5ca5cbd --- /dev/null +++ b/workflows/paleogenomics/adna-analysis/.dockstore.yml @@ -0,0 +1,11 @@ +version: 1.2 +workflows: +- name: adna-analysis + subclass: Galaxy + publish: true + primaryDescriptorPath: /adna-analysis.ga + testParameterFiles: + - /adna-analysis-tests.yml + authors: + - name: Ali Mert AYDIN + orcid: "https://orcid.org/0009-0008-9038-0815" diff --git a/workflows/paleogenomics/adna-analysis/CHANGELOG.md b/workflows/paleogenomics/adna-analysis/CHANGELOG.md new file mode 100644 index 0000000000..4849f5e7c4 --- /dev/null +++ b/workflows/paleogenomics/adna-analysis/CHANGELOG.md @@ -0,0 +1,5 @@ +# Changelog + +## [0.1] - 2026-05-18 + +- First release. \ No newline at end of file diff --git a/workflows/paleogenomics/adna-analysis/README.md b/workflows/paleogenomics/adna-analysis/README.md new file mode 100644 index 0000000000..df53610a4c --- /dev/null +++ b/workflows/paleogenomics/adna-analysis/README.md @@ -0,0 +1,82 @@ +# Ancient DNA analysis pipeline +This workflow performs an ancient DNA (aDNA) based analysis similar to the one in the [nf-core/eager](https://nf-co.re/eager/2.5.3/) workflow. nf-core/eager is a bioinformatics best-practice processing pipeline for genomic NGS sequencing data, with a focus on ancient DNA data. It is ideal for the (palaeo)genomic analysis of humans, animals, plants, microbes and even microbiomes. + +The pipeline processes the sequencing-read input provided to the workflow together with a reference genome and optional supporting reference data. It aligns reads and performs extensive general NGS and aDNA-specific quality control on the results. + + +## Required & Optional Inputs +To run this workflow successfully, you need to provide the following input datasets and parameters: + +* **`Choose Read Type` :** Select whether your input is Single-End or Paired-End. +* **`Input Single-end reads` :** Input single-end FASTQ reads (list collection) for the sample. +* **`Input Paired-end Forward reads (R1)` :** Input paired-end forward FASTQ reads (list collection) for the sample. +* **`Input Paired-end reverse reads (R2)` :** Input paired-end reverse FASTQ reads (list collection) for the sample. +* **`Reference genome` :** Reference genome sequence in FASTA format. This is essential for read mapping and variant calling. +* **`Choose Mapper` :** Switch to select the alignment tool. Choose between BWA and Bowtie2. +* **`HapMap chromosome X reference` :** Optional HapMap dataset used for X-chromosome contamination estimation in ANGSD (used only if provided). +* **`Input Mitochondrial Chromosome Name` :** The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS). +* **`Kraken2 database directory` :** The database directory required for Kraken2 taxonomic classification. +* **`Optional BED file for Sex.DetERRmine` :** An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms. +* **`ANGSD region parameter` :** The specific genomic region to restrict the ANGSD analysis (e.g. 'X:5000000-154900000' for human male nuclear contamination estimation; adjust for your reference). + + +## Workflow Steps +By default the pipeline currently performs the following: + +## 1. Preprocessing and Quality Control +* **Quality Control:** Evaluates read quality before and after trimming (`FastQC`) +* **Adapter Trimming:** Removes adapter sequences (`AdapterRemoval`) + +## 2. Read Mapping and Processing +* **Alignment:** Maps reads to the provided reference genome conditionally using either (`BWA`) or (`Bowtie2`) based on user selection +* **Filtering and Statistics:** Separates unmapped reads and calculates alignment statistics (`Samtools View and Flagstat`) +* **Duplicate Removal:** Detects and marks PCR duplicates (`Picard MarkDuplicates`) +* **Alignment Quality:** Generates detailed BAM quality metrics (`QualiMap BamQC`) +* **Library Complexity:** Estimates library complexity (`Preseq`) + +## 3. Ancient DNA (aDNA) Analysis +* **Damage Profiling:** Visualizes aDNA-specific C-to-T damage patterns (`mapDamage`) +* **Endogenous Content:** Calculates the proportion of endogenous (target) DNA in the sample (`EndorSpy`) +* **(`Optional`) Contamination:** Estimates nuclear X-chromosome contamination conditionally if HapMap data is provided (`ANGSD X-Contamination`) + +## 4. Biological Information +* **Sex Determination:** Determines biological sex based on relative chromosome coverage ratio. This step adapts conditionally whether an optional BED file is provided (`Sex.DetERRmine`) +* **Mt/Nuc Ratio:** Calculates the ratio of mitochondrial reads to nuclear reads utilizing the specified mitochondrial chromosome name (`MtNucRatioCalculator`) + +## 5. Genotyping +* **Variant Analysis:** Performs variant calling to generate VCF files (`FreeBayes`) +* **Variant Statistics:** Calculates statistics for the generated variants (`Bcftools stats`) + +## 6. Metagenomic Screening (For Unmapped Reads) +* **Read Extraction:** Extracts unmapped reads for microbial analysis (`Picard SamToFastq`) +* **Quality Filter:** Filters low-complexity sequences (`BBTools BBduk`) +* **Taxonomic Classification:** Performs microbiome/taxonomic screening on the filtered unmapped reads (`Kraken2`) + +## 7. Reporting +* **Summary Report:** Aggregates logs and statistics from all these tools into a single interactive HTML report (`MultiQC`) + + +## Workflow Outputs +Upon successful execution, the workflow explicitly provides the following final files for analysis: + +* **`MultiQC aggregated workflow summary report` :** An interactive HTML report aggregating QC and analysis logs from all tools. +* **`QualiMap BamQC general alignment quality metrics report` :** A detailed HTML report containing mapping quality metrics, GC content, and coverage statistics. +* **`mapDamage Visualisation` :** Visual plots displaying the characteristic C-to-T deamination patterns at the ends of ancient DNA reads. +* **`Kraken2 taxonomic classification and microbial screening report` :** A tabular report showing the taxonomic classification of unmapped reads. +* **`EndorSpy endogenous DNA authentication report` :** A JSON file containing the calculated endogenous DNA percentage. +* **`Sex.DetERRmine (Without BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for human-genome alignments. +* **`Sex.DetERRmine (With BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for targeted capture regions. +* **`Mitochondrial to nuclear DNA ratio calculation report` :** A JSON file containing the calculated ratio between mitochondrial and nuclear reads. +* **`ANGSD report of nuclear contamination estimation` :** A tabular text file detailing the estimates of nuclear X-chromosome contamination. +* **`Bcftools variant calling summary statistics report` :** A text file containing comprehensive summary statistics for the called variants (VCF). +* **`Fully post-processed mapping results` :** The final deduplicated and filtered alignment BAM file. +* **`FreeBayes raw genomic variant calls` :** The raw VCF file generated from variant analysis. + + +## Testing Data +To ensure the workflow functions correctly, it was validated using the following datasets and databases: + +* **`Primary Test Data` :** A downsampled paired-end FASTQ dataset [NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz](https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz) and [NIST7035_TAAGGCGA_L001_R2_001_10MB.fastq.gz](https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R2_001_10MB.fastq.gz) optimized for rapid workflow testing and validation. +* **`Primary Reference Genome` :** The [hs37d5_chr21-MT.fa.gz](https://github.com/nf-core/test-datasets/blob/eager/reference/Human/hs37d5_chr21-MT.fa.gz) file was utilized as the primary reference genome sequence. +* **`X-Chromosome Contamination Reference` :** The [HapMap ChrX](https://github.com/ANGSD/angsd/blob/master/RES/HapMapChrX.gz) dataset was provided as the initial reference for the estimation of X-chromosome contamination using the ANGSD tool. +* **`Taxonomic Classification Database` :** The Minikraken v2 database was utilized to perform taxonomic classification via Kraken2. \ No newline at end of file diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml new file mode 100644 index 0000000000..09d85de465 --- /dev/null +++ b/workflows/paleogenomics/adna-analysis/adna-analysis-tests.yml @@ -0,0 +1,185 @@ +- doc: Test outline for adna-analysis.ga (Single-End, BWA, No BED, HapMap Present) + job: + Choose Read Type: Single-End + Input Single-end reads: + class: Collection + collection_type: list + elements: + - class: File + identifier: NIST7035 + location: https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz + filetype: fastqsanger.gz + Reference genome: + class: File + location: https://github.com/nf-core/test-datasets/raw/eager/reference/Human/hs37d5_chr21-MT.fa.gz + filetype: fasta.gz + HapMap chromosome X reference: + class: File + location: https://github.com/ANGSD/angsd/raw/master/RES/HapMapChrX.gz + filetype: gz + Choose Mapper: BWA + Optional BED file for Sex.DetERRmine: null + Kraken2 database directory: viral2019-03 + outputs: + Fully post-processed mapping results: + element_tests: + NIST7035: + asserts: + has_size: + min: 100 + EndorSpy endogenous DNA authentication report: + element_tests: + NIST7035: + asserts: + has_text: + text: "percent_on_target" + Sex.DetERRmine (Without BED) report of chromosomal gender estimation: + element_tests: + NIST7035: + asserts: + has_text: + text: "Sex.DetERRmine" + QualiMap BamQC general alignment quality metrics report: + element_tests: + NIST7035: + asserts: + has_text: + text: "Qualimap Report: BAM QC" + Mitochondrial to nuclear DNA ratio calculation report: + element_tests: + NIST7035: + asserts: + has_text: + text: "mtnuccalculator" + mapDamage Visualisation: + element_tests: + NIST7035: + element_tests: + dnacomp: + asserts: + has_text: + text: "mapDamage" + FreeBayes raw genomic variant calls: + element_tests: + NIST7035: + asserts: + has_text: + text: "freeBayes" + ANGSD report of nuclear contamination estimation: + element_tests: + NIST7035: + asserts: + has_text: + text: "Method1_MOM_estimate" + Bcftools variant calling summary statistics report: + element_tests: + NIST7035: + asserts: + has_text: + text: "ACT>TCGA" + Kraken2 taxonomic classification and microbial screening report: + element_tests: + NIST7035: + asserts: + has_text: + text: "root" + MultiQC aggregated workflow summary report: + element_tests: + NIST7035: + asserts: + has_text: + text: "MultiQC" + +- doc: Test outline for adna-analysis.ga (Paired-End, Bowtie2, BED Present, No HapMap) + job: + Choose Read Type: Paired-End + Input Paired-end Forward reads (R1): + class: Collection + collection_type: list + elements: + - class: File + identifier: NIST7035 + location: https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz + filetype: fastqsanger.gz + Input Paired-end reverse reads (R2): + class: Collection + collection_type: list + elements: + - class: File + identifier: NIST7035 + location: https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R2_001_10MB.fastq.gz + filetype: fastqsanger.gz + Reference genome: + class: File + location: https://github.com/nf-core/test-datasets/raw/eager/reference/Human/hs37d5_chr21-MT.fa.gz + filetype: fasta.gz + HapMap chromosome X reference: null + Choose Mapper: Bowtie2 + Optional BED file for Sex.DetERRmine: + class: File + location: https://github.com/nf-core/test-datasets/raw/eager/reference/Human/1240K.pos.list_hs37d5.0based.bed.gz + filetype: tabular + Kraken2 database directory: viral2019-03 + outputs: + Fully post-processed mapping results: + element_tests: + NIST7035: + asserts: + has_size: + min: 100 + EndorSpy endogenous DNA authentication report: + element_tests: + NIST7035: + asserts: + has_text: + text: "percent_on_target" + Sex.DetERRmine (With BED) report of chromosomal gender estimation: + element_tests: + NIST7035: + asserts: + has_text: + text: "Sex.DetERRmine" + QualiMap BamQC general alignment quality metrics report: + element_tests: + NIST7035: + asserts: + has_text: + text: "Qualimap Report: BAM QC" + Mitochondrial to nuclear DNA ratio calculation report: + element_tests: + NIST7035: + asserts: + has_text: + text: "mtnuccalculator" + mapDamage Visualisation: + element_tests: + NIST7035: + element_tests: + dnacomp: + asserts: + has_text: + text: "mapDamage" + FreeBayes raw genomic variant calls: + element_tests: + NIST7035: + asserts: + has_text: + text: "freeBayes" + Bcftools variant calling summary statistics report: + element_tests: + NIST7035: + asserts: + has_text: + text: "ACT>TCGA" + Kraken2 taxonomic classification and microbial screening report: + element_tests: + NIST7035: + asserts: + has_text: + text: "root" + MultiQC aggregated workflow summary report: + element_tests: + NIST7035: + asserts: + has_text: + text: "MultiQC" diff --git a/workflows/paleogenomics/adna-analysis/adna-analysis.ga b/workflows/paleogenomics/adna-analysis/adna-analysis.ga new file mode 100644 index 0000000000..e89d090c5f --- /dev/null +++ b/workflows/paleogenomics/adna-analysis/adna-analysis.ga @@ -0,0 +1,2463 @@ +{ + "a_galaxy_workflow": "true", + "annotation": "This workflow performs ancient DNA analysis similar to the nf-core/eager workflow to analyze sequencing data and generate alignment and authentication results", + "comments": [], + "creator": [ + { + "class": "Person", + "identifier": "https://orcid.org/0009-0008-9038-0815", + "name": "Ali Mert AYDIN" + } + ], + "format-version": "0.1", + "license": "MIT", + "release": "0.1", + "name": "Ancient DNA analysis", + "readme": "# Ancient DNA analysis pipeline\nThis workflow performs an ancient DNA (aDNA) based analysis similar to the one in the [nf-core/eager](https://nf-co.re/eager/2.5.3/) workflow. nf-core/eager is a bioinformatics best-practice processing pipeline for genomic NGS sequencing data, with a focus on ancient DNA data. It is ideal for the (palaeo)genomic analysis of humans, animals, plants, microbes and even microbiomes.\n\nThe pipeline processes the sequencing-read input provided to the workflow together with a reference genome and optional supporting reference data. It aligns reads and performs extensive general NGS and aDNA-specific quality control on the results.\n\n\n## Required & Optional Inputs\nTo run this workflow successfully, you need to provide the following input datasets and parameters:\n\n* **`Choose Read Type` :** Select whether your input is Single-End or Paired-End.\n* **`Input Single-end reads` :** Input single-end FASTQ reads (list collection) for the sample.\n* **`Input Paired-end Forward reads (R1)` :** Input paired-end forward FASTQ reads (list collection) for the sample.\n* **`Input Paired-end reverse reads (R2)` :** Input paired-end reverse FASTQ reads (list collection) for the sample.\n* **`Reference genome` :** Reference genome sequence in FASTA format. This is essential for read mapping and variant calling.\n* **`Choose Mapper` :** Switch to select the alignment tool. Choose between BWA and Bowtie2.\n* **`HapMap chromosome X reference` :** Optional HapMap dataset used for X-chromosome contamination estimation in ANGSD (used only if provided).\n* **`Input Mitochondrial Chromosome Name` :** The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS).\n* **`Kraken2 database directory` :** The database directory required for Kraken2 taxonomic classification.\n* **`Optional BED file for Sex.DetERRmine` :** An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms.\n* **`ANGSD region parameter` :** The specific genomic region to restrict the ANGSD analysis (e.g. 'X:5000000-154900000' for human male nuclear contamination estimation; adjust for your reference).\n\n\n## Workflow Steps\nBy default the pipeline currently performs the following:\n\n## 1. Preprocessing and Quality Control\n* **Quality Control:** Evaluates read quality before and after trimming (`FastQC`)\n* **Adapter Trimming:** Removes adapter sequences (`AdapterRemoval`)\n\n## 2. Read Mapping and Processing\n* **Alignment:** Maps reads to the provided reference genome conditionally using either (`BWA`) or (`Bowtie2`) based on user selection\n* **Filtering and Statistics:** Separates unmapped reads and calculates alignment statistics (`Samtools View and Flagstat`)\n* **Duplicate Removal:** Detects and marks PCR duplicates (`Picard MarkDuplicates`)\n* **Alignment Quality:** Generates detailed BAM quality metrics (`QualiMap BamQC`)\n* **Library Complexity:** Estimates library complexity (`Preseq`)\n\n## 3. Ancient DNA (aDNA) Analysis\n* **Damage Profiling:** Visualizes aDNA-specific C-to-T damage patterns (`mapDamage`)\n* **Endogenous Content:** Calculates the proportion of endogenous (target) DNA in the sample (`EndorSpy`)\n* **(`Optional`) Contamination:** Estimates nuclear X-chromosome contamination conditionally if HapMap data is provided (`ANGSD X-Contamination`)\n\n## 4. Biological Information\n* **Sex Determination:** Determines biological sex based on relative chromosome coverage ratio. This step adapts conditionally whether an optional BED file is provided (`Sex.DetERRmine`)\n* **Mt/Nuc Ratio:** Calculates the ratio of mitochondrial reads to nuclear reads utilizing the specified mitochondrial chromosome name (`MtNucRatioCalculator`)\n\n## 5. Genotyping\n* **Variant Analysis:** Performs variant calling to generate VCF files (`FreeBayes`)\n* **Variant Statistics:** Calculates statistics for the generated variants (`Bcftools stats`)\n\n## 6. Metagenomic Screening (For Unmapped Reads)\n* **Read Extraction:** Extracts unmapped reads for microbial analysis (`Picard SamToFastq`)\n* **Quality Filter:** Filters low-complexity sequences (`BBTools BBduk`)\n* **Taxonomic Classification:** Performs microbiome/taxonomic screening on the filtered unmapped reads (`Kraken2`)\n\n## 7. Reporting\n* **Summary Report:** Aggregates logs and statistics from all these tools into a single interactive HTML report (`MultiQC`)\n\n\n## Workflow Outputs\nUpon successful execution, the workflow explicitly provides the following final files for analysis:\n\n* **`MultiQC aggregated workflow summary report` :** An interactive HTML report aggregating QC and analysis logs from all tools.\n* **`QualiMap BamQC general alignment quality metrics report` :** A detailed HTML report containing mapping quality metrics, GC content, and coverage statistics.\n* **`mapDamage Visualisation` :** Visual plots displaying the characteristic C-to-T deamination patterns at the ends of ancient DNA reads.\n* **`Kraken2 taxonomic classification and microbial screening report` :** A tabular report showing the taxonomic classification of unmapped reads.\n* **`EndorSpy endogenous DNA authentication report` :** A JSON file containing the calculated endogenous DNA percentage.\n* **`Sex.DetERRmine (Without BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for human-genome alignments.\n* **`Sex.DetERRmine (With BED) report of chromosomal gender estimation` :** A JSON file containing biological sex metrics for targeted capture regions.\n* **`Mitochondrial to nuclear DNA ratio calculation report` :** A JSON file containing the calculated ratio between mitochondrial and nuclear reads.\n* **`ANGSD report of nuclear contamination estimation` :** A tabular text file detailing the estimates of nuclear X-chromosome contamination.\n* **`Bcftools variant calling summary statistics report` :** A text file containing comprehensive summary statistics for the called variants (VCF).\n* **`Fully post-processed mapping results` :** The final deduplicated and filtered alignment BAM file.\n* **`FreeBayes raw genomic variant calls` :** The raw VCF file generated from variant analysis.\n\n\n## Testing Data\nTo ensure the workflow functions correctly, it was validated using the following datasets and databases:\n\n* **`Primary Test Data` :** A downsampled paired-end FASTQ dataset [NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz](https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R1_001_10MB.fastq.gz) and [NIST7035_TAAGGCGA_L001_R2_001_10MB.fastq.gz](https://zenodo.org/records/21222737/files/NIST7035_TAAGGCGA_L001_R2_001_10MB.fastq.gz) optimized for rapid workflow testing and validation.\n* **`Primary Reference Genome` :** The [hs37d5_chr21-MT.fa.gz](https://github.com/nf-core/test-datasets/blob/eager/reference/Human/hs37d5_chr21-MT.fa.gz) file was utilized as the primary reference genome sequence.\n* **`X-Chromosome Contamination Reference` :** The [HapMap ChrX](https://github.com/ANGSD/angsd/blob/master/RES/HapMapChrX.gz) dataset was provided as the initial reference for the estimation of X-chromosome contamination using the ANGSD tool.\n* **`Taxonomic Classification Database` :** The Minikraken v2 database was utilized to perform taxonomic classification via Kraken2.", + "report": { + "markdown": "\n# Workflow Execution Report\n\n## Workflow Inputs\n```galaxy\ninvocation_inputs()\n```\n\n## Workflow Outputs\n```galaxy\ninvocation_outputs()\n```\n\n## Workflow\n```galaxy\nworkflow_display()\n```\n" + }, + "steps": { + "0": { + "annotation": "Input single-end FASTQ reads for the sample.", + "content_id": null, + "errors": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "Input single-end FASTQ reads for the sample.", + "name": "Input Single-end reads" + } + ], + "label": "Input Single-end reads", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 2.664238753812697, + "top": 289.4272202709404 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"format\": [\"fastq.gz\", \"fastqsanger.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "f7d7cb77-f9c3-4f80-8c20-a4891e9cbde2", + "when": null, + "workflow_outputs": [] + }, + "1": { + "annotation": "Select the sequencing read type of your input data: Single-End (SE) or Paired-End (PE).", + "content_id": null, + "errors": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "Select the sequencing read type of your input data: Single-End (SE) or Paired-End (PE).", + "name": "Choose Read Type" + } + ], + "label": "Choose Read Type", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 2.439246020506289, + "top": 526.1635652932443 + }, + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictions\": [\"Single-End\", \"Paired-End\"], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "14d93c50-9e41-47c7-ae44-2370ec91b23f", + "when": null, + "workflow_outputs": [] + }, + "2": { + "annotation": "Input paired-end Forward FASTQ reads for the sample. Please ensure that the files in this collection are sorted alphabetically so they correctly match the R2/R1 files.", + "content_id": null, + "errors": null, + "id": 2, + "input_connections": {}, + "inputs": [ + { + "description": "Input paired-end Forward FASTQ reads for the sample. Please ensure that the files in this collection are sorted alphabetically so they correctly match the R2/R1 files.", + "name": "Input Paired-end Forward reads (R1)" + } + ], + "label": "Input Paired-end Forward reads (R1)", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0.8459904296869354, + "top": 791.502398805326 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"format\": [\"fastq.gz\", \"fastqsanger.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "182acaba-5521-4972-9d17-c51a485160f9", + "when": null, + "workflow_outputs": [] + }, + "3": { + "annotation": "Input paired-end Reverse FASTQ reads for the sample. Please ensure that the files in this collection are sorted alphabetically so they correctly match the R2/R1 files.", + "content_id": null, + "errors": null, + "id": 3, + "input_connections": {}, + "inputs": [ + { + "description": "Input paired-end Reverse FASTQ reads for the sample. Please ensure that the files in this collection are sorted alphabetically so they correctly match the R2/R1 files.", + "name": "Input Paired-end reverse reads (R2)" + } + ], + "label": "Input Paired-end reverse reads (R2)", + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 0, + "top": 909.1024659439979 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"format\": [\"fastq.gz\", \"fastqsanger.gz\"], \"tag\": null, \"collection_type\": \"list\", \"fields\": null, \"column_definitions\": null}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "8bc74801-26a1-4ea3-90a4-46ba6d8ee2eb", + "when": null, + "workflow_outputs": [] + }, + "4": { + "annotation": "Switch to select the alignment tool.", + "content_id": null, + "errors": null, + "id": 4, + "input_connections": {}, + "inputs": [ + { + "description": "Switch to select the alignment tool.", + "name": "Choose Mapper" + } + ], + "label": "Choose Mapper", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 1594.510627584606, + "top": 1441.097440599871 + }, + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictions\": [\"BWA\", \"Bowtie2\"], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "6fb6f861-a6bf-4cc7-9afd-0bbbcb8d6c6c", + "when": null, + "workflow_outputs": [] + }, + "5": { + "annotation": "An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms.", + "content_id": null, + "errors": null, + "id": 5, + "input_connections": {}, + "inputs": [ + { + "description": "An optional BED file containing specific genomic coordinates to restrict the Sex.DetERRmine analysis. Leave empty for standard whole-genome human analysis, or provide targeted regions to enable gender estimation for non-human organisms.", + "name": "Optional BED file for Sex.DetERRmine" + } + ], + "label": "Optional BED file for Sex.DetERRmine", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 3000.721983263028, + "top": 250.7172256717161 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "ab2309d8-46e7-4142-a5fa-f35008e090d8", + "when": null, + "workflow_outputs": [] + }, + "6": { + "annotation": "Reference genome sequence in FASTA format.", + "content_id": null, + "errors": null, + "id": 6, + "input_connections": {}, + "inputs": [ + { + "description": "Reference genome sequence in FASTA format.", + "name": "Reference genome" + } + ], + "label": "Reference genome", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 1796.9138118486842, + "top": 2815.7042121761183 + }, + "tool_id": null, + "tool_state": "{\"optional\": false, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "ce609edc-8e3a-4a48-8599-217da2720699", + "when": null, + "workflow_outputs": [] + }, + "7": { + "annotation": "The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS).", + "content_id": null, + "errors": null, + "id": 7, + "input_connections": {}, + "inputs": [ + { + "description": "The exact header name of the mitochondrial chromosome in your reference FASTA file (e.g., MT, chrM, rCRS).", + "name": "Input Mitochondrial Chromosome Name" + } + ], + "label": "Input Mitochondrial Chromosome Name", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 3398.859031200616, + "top": 1820.2483542649397 + }, + "tool_id": null, + "tool_state": "{\"default\": \"MT\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "3dda9710-d18b-4622-90d9-4bfba0cda536", + "when": null, + "workflow_outputs": [] + }, + "8": { + "annotation": "HapMap dataset required for X-chromosome contamination estimation in ANGSD.", + "content_id": null, + "errors": null, + "id": 8, + "input_connections": {}, + "inputs": [ + { + "description": "HapMap dataset required for X-chromosome contamination estimation in ANGSD.", + "name": "HapMap chromosome X reference" + } + ], + "label": "HapMap chromosome X reference", + "name": "Input dataset", + "outputs": [], + "position": { + "left": 3395.379322008525, + "top": 1939.9203398218317 + }, + "tool_id": null, + "tool_state": "{\"optional\": true, \"tag\": null}", + "tool_version": null, + "type": "data_input", + "uuid": "065dc0b0-f3a8-40f7-b433-d9073fb0a4fd", + "when": null, + "workflow_outputs": [] + }, + "9": { + "annotation": "The specific genomic region to restrict the ANGSD analysis (e.g. 'X:5000000-154900000' for human male nuclear contamination estimation; adjust for your reference).", + "content_id": null, + "errors": null, + "id": 9, + "input_connections": {}, + "inputs": [ + { + "description": "The specific genomic region to restrict the ANGSD analysis (e.g. 'X:5000000-154900000' for human male nuclear contamination estimation; adjust for your reference).", + "name": "ANGSD region parameter" + } + ], + "label": "ANGSD region parameter", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 3396.4476380257142, + "top": 2031.492121077198 + }, + "tool_id": null, + "tool_state": "{\"default\": \"X:5000000-154900000\", \"multiple\": false, \"validators\": [], \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "74a40872-f977-4ebb-8eb0-7bfa6508ca74", + "when": null, + "workflow_outputs": [] + }, + "10": { + "annotation": "Select the Kraken2 database to use for taxonomic classification (Galaxy data table entry name).", + "content_id": null, + "errors": null, + "id": 10, + "input_connections": {}, + "inputs": [ + { + "description": "Select the Kraken2 database to use for taxonomic classification (Galaxy data table entry name).", + "name": "Kraken2 database directory" + } + ], + "label": "Kraken2 database directory", + "name": "Input parameter", + "outputs": [], + "position": { + "left": 3797.3606526684393, + "top": 2314.3293180770384 + }, + "tool_id": null, + "tool_state": "{\"multiple\": false, \"validators\": [], \"restrictOnConnections\": true, \"parameter_type\": \"text\", \"optional\": false}", + "tool_version": null, + "type": "parameter_input", + "uuid": "ed8e4694-68ad-4d93-a475-42ba9a9eb7ed", + "when": null, + "workflow_outputs": [] + }, + "11": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 11, + "input_connections": { + "input_param_type|input_param": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": "Map Single-End", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 403.1574299794747, + "top": 415.74528995215593 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"Single-End\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "5fa35466-18a8-4f82-8c3d-cbe6ef5e0844", + "when": null, + "workflow_outputs": [] + }, + "12": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 12, + "input_connections": { + "input_param_type|input_param": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": "Map Paired-End", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 403.5767973730499, + "top": 648.6897058677423 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"Paired-End\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "e4bb17bc-3af7-463f-8e5a-278accabf1c9", + "when": null, + "workflow_outputs": [] + }, + "13": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 13, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": "Map BWA Selected", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 2147.120250466345, + "top": 1350.559153101337 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"BWA\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "f39564d9-9c1a-459a-bcce-27958b2d8030", + "when": null, + "workflow_outputs": [] + }, + "14": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 14, + "input_connections": { + "input_param_type|input_param": { + "id": 4, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": "Map Bowtie2 Selected", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 2146.573096848896, + "top": 1510.2292899345625 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"Bowtie2\", \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "7e68999f-4e2a-439c-baec-3d4c96cbf3cd", + "when": null, + "workflow_outputs": [] + }, + "15": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 15, + "input_connections": { + "input_param_type|input_param": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": "Map BED Absent", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 3401.103547317789, + "top": 110.37848452931166 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"null\", \"to\": \"True\"}, {\"__index__\": 1, \"from\": null, \"to\": \"True\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"False\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "719ca7c9-40f9-4824-a964-d30c769ca649", + "when": null, + "workflow_outputs": [] + }, + "16": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 16, + "input_connections": { + "input_param_type|input_param": { + "id": 5, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": "Map BED Present", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 3400.920301969547, + "top": 331.17098732155233 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"null\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": null, \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "2e3b19f9-9761-432d-8aa3-729384d4965d", + "when": null, + "workflow_outputs": [] + }, + "17": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "errors": null, + "id": 17, + "input_connections": { + "input_param_type|input_param": { + "id": 8, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map parameter value", + "name": "input_param_type" + } + ], + "label": "Map Hap Map reference Present", + "name": "Map parameter value", + "outputs": [ + { + "name": "output_param_boolean", + "type": "expression.json" + } + ], + "position": { + "left": 3795.9281163977403, + "top": 1851.7401138920998 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_param_value/map_param_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "5ac8a4bf7a8d", + "name": "map_param_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_param_type\": {\"type\": \"text\", \"__current_case__\": 0, \"input_param\": {\"__class__\": \"ConnectedValue\"}, \"mappings\": [{\"__index__\": 0, \"from\": \"null\", \"to\": \"False\"}, {\"__index__\": 1, \"from\": null, \"to\": \"False\"}]}, \"output_param_type\": \"boolean\", \"unmapped\": {\"on_unmapped\": \"default\", \"__current_case__\": 2, \"default_value\": \"True\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "aace4dd5-12b7-4dab-a9a4-ff08b1408f44", + "when": null, + "workflow_outputs": [] + }, + "18": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", + "errors": null, + "id": 18, + "input_connections": { + "input_type_cond|read1": { + "id": 0, + "output_name": "output" + }, + "when": { + "id": 11, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", + "name": "fastq_trimming_options" + }, + { + "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", + "name": "input_type_cond" + } + ], + "label": "AdapterRemoval (Single-End)", + "name": "AdapterRemoval: remove adapter sequences", + "outputs": [ + { + "name": "output_settings", + "type": "txt" + }, + { + "name": "output_truncated", + "type": "fastqsanger" + } + ], + "position": { + "left": 782.2025979179566, + "top": 739.0149130947038 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "ff174ae7a02f", + "name": "adapter_removal", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"fastq_merging_options\": {\"collapse\": false, \"minalignmentlength\": \"11\", \"collapse_deterministic\": false, \"collapse_conservatively\": false}, \"fastq_options\": {\"qualitymax\": \"41\", \"mask_degenerate_bases\": false, \"convert_uracils\": false}, \"fastq_trimming_options\": {\"adapter1\": \"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC\", \"adapter2\": \"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA\", \"adapter_list\": {\"__class__\": \"RuntimeValue\"}, \"minadapteroverlap\": \"1\", \"mm\": \"3.0\", \"shift\": \"2\", \"trim5p_cond\": {\"trim5p_param\": \"no\", \"__current_case__\": 0}, \"trim3p_cond\": {\"trim3p_param\": \"no\", \"__current_case__\": 0}, \"trimns\": true, \"maxns\": \"1000\", \"trimqualities\": true, \"sliding_window_cond\": {\"sliding_window_param\": \"no\", \"__current_case__\": 0}, \"minquality\": \"20\", \"preserve5p\": false, \"minlength\": \"30\", \"maxlength\": \"4294967295\"}, \"input_type_cond\": {\"input_type\": \"single\", \"__current_case__\": 0, \"read1\": {\"__class__\": \"ConnectedValue\"}}, \"output_select\": \"none\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3.4+galaxy0", + "type": "tool", + "uuid": "df891e41-1311-41ff-821d-6defc40909f2", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "19": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "errors": null, + "id": 19, + "input_connections": { + "input_file": { + "id": 0, + "output_name": "output" + }, + "when": { + "id": 11, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool FastQC", + "name": "adapters" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "contaminants" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "limits" + } + ], + "label": "FastQC (pre-Trimming SE)", + "name": "FastQC", + "outputs": [ + { + "name": "html_file", + "type": "html" + }, + { + "name": "text_file", + "type": "txt" + } + ], + "position": { + "left": 1585.0605375620003, + "top": 0 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "tool_shed_repository": { + "changeset_revision": "2c64fded1286", + "name": "fastqc", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapters\": {\"__class__\": \"RuntimeValue\"}, \"contaminants\": {\"__class__\": \"RuntimeValue\"}, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"kmers\": \"7\", \"limits\": {\"__class__\": \"RuntimeValue\"}, \"min_length\": null, \"nogroup\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.74+galaxy1", + "type": "tool", + "uuid": "38c90015-94fe-4ec2-b260-c59eb5a5a6c1", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "20": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", + "errors": null, + "id": 20, + "input_connections": { + "input_type_cond|read1": { + "id": 2, + "output_name": "output" + }, + "input_type_cond|read2": { + "id": 3, + "output_name": "output" + }, + "when": { + "id": 12, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", + "name": "fastq_trimming_options" + }, + { + "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", + "name": "input_type_cond" + }, + { + "description": "runtime parameter for tool AdapterRemoval: remove adapter sequences", + "name": "input_type_cond" + } + ], + "label": "AdapterRemoval (Paired-End)", + "name": "AdapterRemoval: remove adapter sequences", + "outputs": [ + { + "name": "output_settings", + "type": "txt" + }, + { + "name": "output_forward_truncated", + "type": "fastqsanger" + }, + { + "name": "output_reverse_truncated", + "type": "fastqsanger" + }, + { + "name": "output_collapsed", + "type": "fastqsanger" + } + ], + "position": { + "left": 784.2964630407706, + "top": 999.32811668041 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/adapter_removal/adapter_removal/2.3.4+galaxy0", + "tool_shed_repository": { + "changeset_revision": "ff174ae7a02f", + "name": "adapter_removal", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"fastq_merging_options\": {\"collapse\": true, \"minalignmentlength\": \"11\", \"collapse_deterministic\": false, \"collapse_conservatively\": false}, \"fastq_options\": {\"qualitymax\": \"41\", \"mask_degenerate_bases\": false, \"convert_uracils\": false}, \"fastq_trimming_options\": {\"adapter1\": \"AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC\", \"adapter2\": \"AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA\", \"adapter_list\": {\"__class__\": \"RuntimeValue\"}, \"minadapteroverlap\": \"1\", \"mm\": \"3.0\", \"shift\": \"2\", \"trim5p_cond\": {\"trim5p_param\": \"no\", \"__current_case__\": 0}, \"trim3p_cond\": {\"trim3p_param\": \"no\", \"__current_case__\": 0}, \"trimns\": true, \"maxns\": \"1000\", \"trimqualities\": true, \"sliding_window_cond\": {\"sliding_window_param\": \"no\", \"__current_case__\": 0}, \"minquality\": \"20\", \"preserve5p\": false, \"minlength\": \"30\", \"maxlength\": \"4294967295\"}, \"input_type_cond\": {\"input_type\": \"pair\", \"__current_case__\": 1, \"read1\": {\"__class__\": \"ConnectedValue\"}, \"read2\": {\"__class__\": \"ConnectedValue\"}, \"identify_adapters\": false, \"interleaved_output\": \"no\", \"combined_output\": false}, \"output_select\": [\"output_collapsed\"], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3.4+galaxy0", + "type": "tool", + "uuid": "719806af-ed50-428a-8ccb-a0f5dccaf623", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "21": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "errors": null, + "id": 21, + "input_connections": { + "input_file": { + "id": 2, + "output_name": "output" + }, + "when": { + "id": 12, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool FastQC", + "name": "adapters" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "contaminants" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "limits" + } + ], + "label": "FastQC (pre-Trimming PE R1)", + "name": "FastQC", + "outputs": [ + { + "name": "html_file", + "type": "html" + }, + { + "name": "text_file", + "type": "txt" + } + ], + "position": { + "left": 1585.7799744899196, + "top": 322.06332643542777 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "tool_shed_repository": { + "changeset_revision": "2c64fded1286", + "name": "fastqc", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapters\": {\"__class__\": \"RuntimeValue\"}, \"contaminants\": {\"__class__\": \"RuntimeValue\"}, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"kmers\": \"7\", \"limits\": {\"__class__\": \"RuntimeValue\"}, \"min_length\": null, \"nogroup\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.74+galaxy1", + "type": "tool", + "uuid": "f0ba3dcf-57c6-4000-87a1-0477a1e6abe1", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "22": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "errors": null, + "id": 22, + "input_connections": { + "input_file": { + "id": 3, + "output_name": "output" + }, + "when": { + "id": 12, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool FastQC", + "name": "adapters" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "contaminants" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "limits" + } + ], + "label": "FastQC (pre-Trimming PE R2)", + "name": "FastQC", + "outputs": [ + { + "name": "html_file", + "type": "html" + }, + { + "name": "text_file", + "type": "txt" + } + ], + "position": { + "left": 1592.3513985296054, + "top": 646.7580173451056 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "tool_shed_repository": { + "changeset_revision": "2c64fded1286", + "name": "fastqc", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapters\": {\"__class__\": \"RuntimeValue\"}, \"contaminants\": {\"__class__\": \"RuntimeValue\"}, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"kmers\": \"7\", \"limits\": {\"__class__\": \"RuntimeValue\"}, \"min_length\": null, \"nogroup\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.74+galaxy1", + "type": "tool", + "uuid": "0413f971-5f19-4890-bd7a-14ce7e0d959c", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "23": { + "annotation": "", + "content_id": "cat1", + "errors": null, + "id": 23, + "input_connections": { + "input1": { + "id": 20, + "output_name": "output_forward_truncated" + }, + "queries_0|input2": { + "id": 20, + "output_name": "output_reverse_truncated" + }, + "queries_1|input2": { + "id": 20, + "output_name": "output_collapsed" + }, + "when": { + "id": 12, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "Concatenate multiple datasets or collections", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 1133.172763354761, + "top": 1164.4768961452494 + }, + "post_job_actions": {}, + "tool_id": "cat1", + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"queries\": [{\"__index__\": 0, \"input2\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"input2\": {\"__class__\": \"ConnectedValue\"}}], \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.0.0", + "type": "tool", + "uuid": "5a3b1eab-9a87-4f33-a266-97fa750ff016", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "24": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 24, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 18, + "output_name": "output_settings" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 20, + "output_name": "output_settings" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 3797.783377292731, + "top": 947.6518390311671 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "5717f622-448c-46ff-99cc-a03ee9d3d5e2", + "when": null, + "workflow_outputs": [] + }, + "25": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 25, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 19, + "output_name": "text_file" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 21, + "output_name": "text_file" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2139.8290063486693, + "top": 204.97457125871202 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "762ac3dd-21f0-47a2-b5de-e5843eb4d678", + "when": null, + "workflow_outputs": [] + }, + "26": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 26, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 19, + "output_name": "text_file" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 22, + "output_name": "text_file" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2140.1790174192392, + "top": 362.3220238725469 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "c062d58b-de49-417e-808f-f637182089d3", + "when": null, + "workflow_outputs": [] + }, + "27": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 27, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 18, + "output_name": "output_truncated" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 23, + "output_name": "out_file1" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2143.701427857198, + "top": 1117.8768364170646 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "c23c8e94-acf0-4931-8155-a0d2f5389a17", + "when": null, + "workflow_outputs": [] + }, + "28": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa/0.7.19", + "errors": null, + "id": 28, + "input_connections": { + "input_type|fastq_input1": { + "id": 27, + "output_name": "data_param" + }, + "reference_source|ref_file": { + "id": 6, + "output_name": "output" + }, + "when": { + "id": 13, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Map with BWA", + "name": "input_type" + }, + { + "description": "runtime parameter for tool Map with BWA", + "name": "reference_source" + } + ], + "label": null, + "name": "Map with BWA", + "outputs": [ + { + "name": "bam_output", + "type": "bam" + } + ], + "position": { + "left": 2498.512809270185, + "top": 1317.0113359441348 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bwa/bwa/0.7.19", + "tool_shed_repository": { + "changeset_revision": "1dfc975b48d5", + "name": "bwa", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 1, \"n\": \"0.01\", \"o\": \"2\", \"e\": \"-1\", \"i\": \"5\", \"d\": \"10\", \"l\": \"1024\", \"k\": \"2\", \"m\": \"2000000\", \"M\": \"3\", \"O\": \"11\", \"E\": \"4\", \"R\": \"30\", \"q\": \"0\", \"B\": null, \"L\": null}, \"input_type\": {\"input_type_selector\": \"single\", \"__current_case__\": 2, \"fastq_input1\": {\"__class__\": \"ConnectedValue\"}, \"adv_se_options\": {\"adv_se_options_selector\": \"do_not_set\", \"__current_case__\": 1}}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"ref_file\": {\"__class__\": \"ConnectedValue\"}, \"index_a\": \"auto\"}, \"rg\": {\"rg_selector\": \"set\", \"__current_case__\": 1, \"read_group_id_conditional\": {\"do_auto_name\": true, \"__current_case__\": 0}, \"read_group_sm_conditional\": {\"do_auto_name\": true, \"__current_case__\": 0}, \"PL\": \"ILLUMINA\", \"read_group_lb_conditional\": {\"do_auto_name\": true, \"__current_case__\": 0}, \"CN\": null, \"DS\": null, \"DT\": null, \"FO\": null, \"KS\": null, \"PG\": null, \"PI\": null, \"PU\": null}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.7.19", + "type": "tool", + "uuid": "d099da6f-ba0d-472d-a27e-4b121b232b8a", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "29": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "errors": null, + "id": 29, + "input_connections": { + "input_file": { + "id": 27, + "output_name": "data_param" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool FastQC", + "name": "adapters" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "contaminants" + }, + { + "description": "runtime parameter for tool FastQC", + "name": "limits" + } + ], + "label": "FastQC (post-Trimming)", + "name": "FastQC", + "outputs": [ + { + "name": "html_file", + "type": "html" + }, + { + "name": "text_file", + "type": "txt" + } + ], + "position": { + "left": 2746.571351088597, + "top": 977.7911614562686 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.74+galaxy1", + "tool_shed_repository": { + "changeset_revision": "2c64fded1286", + "name": "fastqc", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"adapters\": {\"__class__\": \"RuntimeValue\"}, \"contaminants\": {\"__class__\": \"RuntimeValue\"}, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"kmers\": \"7\", \"limits\": {\"__class__\": \"RuntimeValue\"}, \"min_length\": null, \"nogroup\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.74+galaxy1", + "type": "tool", + "uuid": "e92ef1a3-fb16-4433-9fea-ff63fb6f8c7b", + "when": null, + "workflow_outputs": [] + }, + "30": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.5+galaxy0", + "errors": null, + "id": 30, + "input_connections": { + "library|input_1": { + "id": 27, + "output_name": "data_param" + }, + "reference_genome|own_file": { + "id": 6, + "output_name": "output" + }, + "when": { + "id": 14, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Bowtie2", + "name": "library" + }, + { + "description": "runtime parameter for tool Bowtie2", + "name": "reference_genome" + } + ], + "label": null, + "name": "Bowtie2", + "outputs": [ + { + "name": "output", + "type": "bam" + } + ], + "position": { + "left": 2499.4930153343485, + "top": 1542.40418792439 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/bowtie2/bowtie2/2.5.5+galaxy0", + "tool_shed_repository": { + "changeset_revision": "a470b376503d", + "name": "bowtie2", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"analysis_type\": {\"analysis_type_selector\": \"full\", \"__current_case__\": 1, \"input_options\": {\"input_options_selector\": \"no\", \"__current_case__\": 1}, \"alignment_options\": {\"alignment_options_selector\": \"no\", \"__current_case__\": 1}, \"scoring_options\": {\"scoring_options_selector\": \"no\", \"__current_case__\": 1}, \"reporting_options\": {\"reporting_options_selector\": \"no\", \"__current_case__\": 0}, \"effort_options\": {\"effort_options_selector\": \"no\", \"__current_case__\": 1}, \"other_options\": {\"other_options_selector\": \"no\", \"__current_case__\": 1}}, \"library\": {\"type\": \"single\", \"__current_case__\": 0, \"input_1\": {\"__class__\": \"ConnectedValue\"}, \"unaligned_file\": false, \"aligned_file\": false}, \"reference_genome\": {\"source\": \"history\", \"__current_case__\": 1, \"own_file\": {\"__class__\": \"ConnectedValue\"}}, \"rg\": {\"rg_selector\": \"set\", \"__current_case__\": 1, \"read_group_id_conditional\": {\"do_auto_name\": \"yes\", \"__current_case__\": 0}, \"read_group_sm_conditional\": {\"do_auto_name\": \"yes\", \"__current_case__\": 0}, \"PL\": \"ILLUMINA\", \"read_group_lb_conditional\": {\"do_auto_name\": \"yes\", \"__current_case__\": 0}, \"CN\": null, \"DS\": null, \"DT\": null, \"FO\": null, \"KS\": null, \"PG\": null, \"PI\": null, \"PU\": null}, \"sam_options\": {\"sam_options_selector\": \"no\", \"__current_case__\": 1}, \"save_mapping_stats\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.5.5+galaxy0", + "type": "tool", + "uuid": "fbdf32b8-2d12-437f-a3a6-52666a58b724", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "31": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 31, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 28, + "output_name": "bam_output" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 30, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 2744.239104092812, + "top": 1391.7675751229958 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "39513036-91a0-4ff5-81c6-39c9172711e6", + "when": null, + "workflow_outputs": [] + }, + "32": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/preseq_c_curve/preseq_c_curve/3.2.0+galaxy0", + "errors": null, + "id": 32, + "input_connections": { + "input_bam": { + "id": 31, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Preseq c_curve", + "outputs": [ + { + "name": "output_tsv", + "type": "tsv" + } + ], + "position": { + "left": 3046.571351088597, + "top": 1157.7911614562686 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/preseq_c_curve/preseq_c_curve/3.2.0+galaxy0", + "tool_shed_repository": { + "changeset_revision": "d8b00ebb1567", + "name": "preseq_c_curve", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"max_read_len\": null, \"step_size\": \"1000\", \"verbose\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.2.0+galaxy0", + "type": "tool", + "uuid": "04647156-f324-4bee-9980-409dc4465778", + "when": null, + "workflow_outputs": [] + }, + "33": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", + "errors": null, + "id": 33, + "input_connections": { + "input1": { + "id": 31, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Samtools flagstat", + "outputs": [ + { + "name": "output1", + "type": "txt" + } + ], + "position": { + "left": 3046.571351088597, + "top": 1307.7911614562686 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", + "tool_shed_repository": { + "changeset_revision": "a0d8e49a018c", + "name": "samtools_flagstat", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"output_fmt\": \"txt\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.0.8", + "type": "tool", + "uuid": "e6e00757-2bb0-4b04-9d77-c9f743aa919e", + "when": null, + "workflow_outputs": [] + }, + "34": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.22+galaxy1", + "errors": null, + "id": 34, + "input_connections": { + "input": { + "id": 31, + "output_name": "data_param" + } + }, + "inputs": [], + "label": null, + "name": "Samtools view", + "outputs": [ + { + "name": "outputsam", + "type": "input" + }, + { + "name": "invoutputsam", + "type": "input" + } + ], + "position": { + "left": 3046.571351088597, + "top": 1567.7911614562686 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/samtools_view/samtools_view/1.22+galaxy1", + "tool_shed_repository": { + "changeset_revision": "5ec526530725", + "name": "samtools_view", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"addref_cond\": {\"addref_select\": \"no\", \"__current_case__\": 0}, \"input\": {\"__class__\": \"ConnectedValue\"}, \"mode\": {\"outtype\": \"selected_reads\", \"__current_case__\": 1, \"filter_config\": {\"cond_region\": {\"select_region\": \"no\", \"__current_case__\": 0}, \"cond_rg\": {\"select_rg\": \"no\", \"__current_case__\": 0}, \"cond_expr\": {\"select_expr\": \"no\", \"__current_case__\": 0}, \"quality\": \"0\", \"library\": null, \"cigarcons\": null, \"inclusive_filter\": null, \"exclusive_filter\": [\"4\"], \"exclusive_filter_all\": null, \"tag\": null, \"qname_file\": {\"__class__\": \"RuntimeValue\"}}, \"subsample_config\": {\"subsampling_mode\": {\"select_subsample\": \"fraction\", \"__current_case__\": 0, \"factor\": \"1.0\", \"seed\": null}}, \"output_options\": {\"reads_report_type\": \"retained\", \"__current_case__\": 0, \"complementary_output\": true, \"adv_output\": {\"readtags\": [], \"collapsecigar\": false}, \"output_format\": {\"oformat\": \"bam\", \"__current_case__\": 2}}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy1", + "type": "tool", + "uuid": "36ba5b51-e8f0-48e7-a4ce-4f737501983f", + "when": null, + "workflow_outputs": [] + }, + "35": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", + "errors": null, + "id": 35, + "input_connections": { + "input1": { + "id": 34, + "output_name": "outputsam" + } + }, + "inputs": [], + "label": "Samtools flagstat after filter", + "name": "Samtools flagstat", + "outputs": [ + { + "name": "output1", + "type": "txt" + } + ], + "position": { + "left": 3396.571351088597, + "top": 1357.7911614562686 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/samtools_flagstat/samtools_flagstat/2.0.8", + "tool_shed_repository": { + "changeset_revision": "a0d8e49a018c", + "name": "samtools_flagstat", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input1\": {\"__class__\": \"ConnectedValue\"}, \"output_fmt\": \"txt\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.0.8", + "type": "tool", + "uuid": "319fb62c-c9a7-4a33-8376-0c50eb506cc4", + "when": null, + "workflow_outputs": [] + }, + "36": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", + "errors": null, + "id": 36, + "input_connections": { + "inputFile": { + "id": 34, + "output_name": "outputsam" + } + }, + "inputs": [], + "label": null, + "name": "MarkDuplicates", + "outputs": [ + { + "name": "metrics_file", + "type": "txt" + }, + { + "name": "outFile", + "type": "bam" + } + ], + "position": { + "left": 3396.5713411647553, + "top": 1567.7912161581917 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_MarkDuplicates/3.1.1.0", + "tool_shed_repository": { + "changeset_revision": "3f254c5ced1d", + "name": "picard", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"assume_sorted\": true, \"barcode_tag\": null, \"comments\": [], \"duplicate_scoring_strategy\": \"SUM_OF_BASE_QUALITIES\", \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"optical_duplicate_pixel_distance\": \"100\", \"read_name_regex\": \"\", \"remove_duplicates\": true, \"validation_stringency\": \"SILENT\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.1.1.0", + "type": "tool", + "uuid": "8c03718a-0bad-48be-80de-138664f66696", + "when": null, + "workflow_outputs": [ + { + "label": "Fully post-processed mapping results", + "output_name": "outFile", + "uuid": "626f2554-3811-4706-b852-45621d96564a" + } + ] + }, + "37": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_SamToFastq/3.1.1.0", + "errors": null, + "id": 37, + "input_connections": { + "inputFile": { + "id": 34, + "output_name": "invoutputsam" + } + }, + "inputs": [], + "label": null, + "name": "SamToFastq", + "outputs": [ + { + "name": "fq_single", + "type": "fastqsanger" + }, + { + "name": "interleaved_fastq", + "type": "fastqsanger" + }, + { + "name": "fq1", + "type": "fastqsanger" + }, + { + "name": "fq2", + "type": "fastqsanger" + }, + { + "name": "fq_u", + "type": "fastqsanger" + } + ], + "position": { + "left": 3396.571351088597, + "top": 2127.7911614562686 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/picard/picard_SamToFastq/3.1.1.0", + "tool_shed_repository": { + "changeset_revision": "3f254c5ced1d", + "name": "picard", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"clipping_action\": \"\", \"clipping_attribute\": \"\", \"include_non_pf_reads\": false, \"include_non_primary_alignments\": false, \"inputFile\": {\"__class__\": \"ConnectedValue\"}, \"re_reverse\": true, \"read1_max_bases_to_write\": \"-1\", \"read1_trim\": \"0\", \"read2_max_bases_to_write\": \"-1\", \"read2_trim\": \"0\", \"single_or_paired\": \"se\", \"validation_stringency\": \"LENIENT\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "3.1.1.0", + "type": "tool", + "uuid": "946af0e8-31b3-4670-beae-9ad33974ffcd", + "when": null, + "workflow_outputs": [] + }, + "38": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/endorspy/endorspy/1.3+galaxy0", + "errors": null, + "id": 38, + "input_connections": { + "post_flagstat": { + "id": 35, + "output_name": "output1" + }, + "pre_flagstat": { + "id": 33, + "output_name": "output1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool EndorSpy", + "name": "dedup_flagstat" + } + ], + "label": null, + "name": "EndorSpy", + "outputs": [ + { + "name": "output_json", + "type": "json" + } + ], + "position": { + "left": 3798.9905778925404, + "top": 1102.6483442426847 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/endorspy/endorspy/1.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "6a999abf5fd4", + "name": "endorspy", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"dedup_flagstat\": {\"__class__\": \"RuntimeValue\"}, \"post_flagstat\": {\"__class__\": \"ConnectedValue\"}, \"pre_flagstat\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.3+galaxy0", + "type": "tool", + "uuid": "4ff74f9e-6ebd-4d5b-9ea1-f9d67edf3c0f", + "when": null, + "workflow_outputs": [ + { + "label": "EndorSpy endogenous DNA authentication report", + "output_name": "output_json", + "uuid": "598c742f-9eb5-4661-8caf-248cc51f6561" + } + ] + }, + "39": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", + "errors": null, + "id": 39, + "input_connections": { + "input_bam": { + "id": 36, + "output_name": "outFile" + }, + "when": { + "id": 15, + "output_name": "output_param_boolean" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Sex.DetERRmine", + "name": "input_bed" + } + ], + "label": "Sex.DetERRmine (Without BED)", + "name": "Sex.DetERRmine", + "outputs": [ + { + "name": "output_report", + "type": "tabular" + }, + { + "name": "output_json", + "type": "json" + } + ], + "position": { + "left": 3802.5535741798576, + "top": 77.70086025053706 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", + "tool_shed_repository": { + "changeset_revision": "cf3d9775d7ae", + "name": "sexdeterrmine", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"base_quality\": \"30\", \"generate_json\": true, \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"input_bed\": {\"__class__\": \"RuntimeValue\"}, \"map_quality\": \"30\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.2+galaxy1", + "type": "tool", + "uuid": "4e668417-4ec2-4c9e-a980-7ac9798221b1", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "Sex.DetERRmine (Without BED) report of chromosomal gender estimation", + "output_name": "output_json", + "uuid": "6721fbbc-cd33-48cf-861e-8c46e92cfdf5" + } + ] + }, + "40": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", + "errors": null, + "id": 40, + "input_connections": { + "input_bam": { + "id": 36, + "output_name": "outFile" + }, + "input_bed": { + "id": 5, + "output_name": "output" + }, + "when": { + "id": 16, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": "Sex.DetERRmine (With BED)", + "name": "Sex.DetERRmine", + "outputs": [ + { + "name": "output_report", + "type": "tabular" + }, + { + "name": "output_json", + "type": "json" + } + ], + "position": { + "left": 3801.003491006426, + "top": 411.77181227426667 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/sexdeterrmine/sexdeterrmine/1.1.2+galaxy1", + "tool_shed_repository": { + "changeset_revision": "cf3d9775d7ae", + "name": "sexdeterrmine", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"base_quality\": \"30\", \"generate_json\": true, \"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"input_bed\": {\"__class__\": \"ConnectedValue\"}, \"map_quality\": \"30\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.1.2+galaxy1", + "type": "tool", + "uuid": "82db9a82-ed78-43bf-92ca-a94580f2da2f", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "Sex.DetERRmine (With BED) report of chromosomal gender estimation", + "output_name": "output_json", + "uuid": "d13c0eaa-3c2a-42b5-bb64-b449e1409baa" + } + ] + }, + "41": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.3+galaxy0", + "errors": null, + "id": 41, + "input_connections": { + "input1": { + "id": 36, + "output_name": "outFile" + } + }, + "inputs": [], + "label": null, + "name": "QualiMap BamQC", + "outputs": [ + { + "name": "raw_data", + "type": "input" + }, + { + "name": "output_html", + "type": "html" + } + ], + "position": { + "left": 3797.597718244943, + "top": 1331.393156072051 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/qualimap_bamqc/qualimap_bamqc/2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "30a201c9c310", + "name": "qualimap_bamqc", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"duplicate_skipping\": null, \"input1\": {\"__class__\": \"ConnectedValue\"}, \"per_base_coverage\": false, \"plot_specific\": {\"n_bins\": \"400\", \"paint_chromosome_limits\": true, \"genome_gc_distr\": null, \"homopolymer_size\": \"3\"}, \"stats_regions\": {\"region_select\": \"all\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.3+galaxy0", + "type": "tool", + "uuid": "df529c99-8475-4abe-b08d-6381fa1c7506", + "when": null, + "workflow_outputs": [ + { + "label": "QualiMap BamQC general alignment quality metrics report", + "output_name": "output_html", + "uuid": "47c590cf-b109-4d1a-97b5-341427fe9dff" + } + ] + }, + "42": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/mtnucratio/mtnucratio/0.7.1+galaxy0", + "errors": null, + "id": 42, + "input_connections": { + "input_bam": { + "id": 36, + "output_name": "outFile" + }, + "mt_chrom_name": { + "id": 7, + "output_name": "output" + } + }, + "inputs": [], + "label": null, + "name": "Mt/Nuc Ratio Calculator", + "outputs": [ + { + "name": "output_report", + "type": "txt" + }, + { + "name": "output_json", + "type": "json" + } + ], + "position": { + "left": 3796.565652486737, + "top": 1544.5893745413882 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/mtnucratio/mtnucratio/0.7.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "bac089482cef", + "name": "mtnucratio", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_bam\": {\"__class__\": \"ConnectedValue\"}, \"mt_chrom_name\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.7.1+galaxy0", + "type": "tool", + "uuid": "1e5805f8-b32c-4b3f-a1b0-9d812b6cece5", + "when": null, + "workflow_outputs": [ + { + "label": "Mitochondrial to nuclear DNA ratio calculation report", + "output_name": "output_json", + "uuid": "0d40de9d-382d-4071-a597-451d63c84b76" + } + ] + }, + "43": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd/0.940+galaxy0", + "errors": null, + "id": 43, + "input_connections": { + "input_bams": { + "id": 36, + "output_name": "outFile" + }, + "region": { + "id": 9, + "output_name": "output" + }, + "when": { + "id": 17, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "ANGSD", + "outputs": [ + { + "name": "output_icnts", + "type": "gz" + } + ], + "position": { + "left": 3797.560186167162, + "top": 2018.1478944190364 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd/0.940+galaxy0", + "tool_shed_repository": { + "changeset_revision": "7b0e59047b2f", + "name": "angsd", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input_bams\": {\"__class__\": \"ConnectedValue\"}, \"min_mapq\": \"30\", \"min_q\": \"30\", \"region\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.940+galaxy0", + "type": "tool", + "uuid": "14301510-0957-4dd6-a410-9f3495de2bda", + "when": "$(inputs.when)", + "workflow_outputs": [] + }, + "44": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_damage/map_damage/2.2.3+galaxy0", + "errors": null, + "id": 44, + "input_connections": { + "reference|history_reference": { + "id": 6, + "output_name": "output" + }, + "sbam_file": { + "id": 36, + "output_name": "outFile" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool mapDamage", + "name": "reference" + } + ], + "label": null, + "name": "mapDamage", + "outputs": [ + { + "name": "damage_visualisation", + "type": "input" + }, + { + "name": "runtime_log", + "type": "txt" + } + ], + "position": { + "left": 3797.26562530735, + "top": 2404.659563343468 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/map_damage/map_damage/2.2.3+galaxy0", + "tool_shed_repository": { + "changeset_revision": "0287e2f82b64", + "name": "map_damage", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"downsampling\": {\"downsampling\": {\"downsampling_type\": \"no_downsampling\", \"__current_case__\": 0}}, \"fasta\": false, \"graphics\": {\"ymax\": \"0.3\", \"readplot\": \"25\", \"refplot\": \"10\", \"title\": null, \"theme_bw\": \"\"}, \"merge_reference_sequences\": false, \"min_basequal\": \"0\", \"reference\": {\"ref_source\": \"history\", \"__current_case__\": 1, \"history_reference\": {\"__class__\": \"ConnectedValue\"}}, \"rescale\": {\"rescaling\": {\"rescale\": \"\", \"__current_case__\": 1}}, \"sbam_file\": {\"__class__\": \"ConnectedValue\"}, \"statistics\": {\"stats\": {\"no_stats\": \"--no-stats\", \"__current_case__\": 1}}, \"window_size\": {\"length\": \"70\", \"around\": \"10\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.2.3+galaxy0", + "type": "tool", + "uuid": "b42619df-22e0-4bf2-9280-c9903b2edd54", + "when": null, + "workflow_outputs": [ + { + "label": "mapDamage Visualisation", + "output_name": "damage_visualisation", + "uuid": "0abc7c16-1590-40ea-802e-2a599f865ba6" + } + ] + }, + "45": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/freebayes/freebayes/1.3.10+galaxy1", + "errors": null, + "id": 45, + "input_connections": { + "reference_source|batchmode|input_bams": { + "id": 36, + "output_name": "outFile" + }, + "reference_source|ref_file": { + "id": 6, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool FreeBayes", + "name": "reference_source" + } + ], + "label": null, + "name": "FreeBayes", + "outputs": [ + { + "name": "output_vcf", + "type": "vcf" + } + ], + "position": { + "left": 3797.7429031173497, + "top": 2711.3938670695097 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/freebayes/freebayes/1.3.10+galaxy1", + "tool_shed_repository": { + "changeset_revision": "0d8581534009", + "name": "freebayes", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"coverage_options\": {\"coverage_options_selector\": \"set\", \"__current_case__\": 0, \"min_coverage\": \"0\", \"limit_coverage\": \"0\", \"skip_coverage\": \"0\"}, \"options_type\": {\"options_type_selector\": \"full\", \"__current_case__\": 0, \"optional_inputs\": {\"optional_inputs_selector\": \"do_not_set\", \"__current_case__\": 1}, \"reporting\": {\"reporting_selector\": \"do_not_set\", \"__current_case__\": 1}, \"population_model\": {\"population_model_selector\": \"set\", \"__current_case__\": 0, \"T\": \"0.01\", \"P\": \"2\", \"J\": false, \"K\": false}, \"reference_allele\": {\"reference_allele_selector\": \"do_not_set\", \"__current_case__\": 1}, \"allele_scope\": {\"allele_scope_selector\": \"do_not_set\", \"__current_case__\": 1}, \"O\": false, \"input_filters\": {\"input_filters_selector\": \"set\", \"__current_case__\": 0, \"standard_filters\": false, \"use_duplicate_reads\": false, \"min_mapping_quality\": \"1\", \"min_base_quality\": \"0\", \"min_supporting_allele_qsum\": \"0\", \"min_supporting_mapping_qsum\": \"0\", \"mismatch_filters\": {\"mismatch_filters_selector\": \"do_not_set\", \"__current_case__\": 1}, \"read_indel_limit\": \"1000\", \"min_alternate_fraction\": \"0.05\", \"min_alternate_qsum\": \"0\", \"min_alternate_count\": \"1\", \"min_alternate_total\": \"1\"}, \"population_mappability_priors\": {\"population_mappability_priors_selector\": \"do_not_set\", \"__current_case__\": 1}, \"genotype_likelihoods\": {\"genotype_likelihoods_selector\": \"do_not_set\", \"__current_case__\": 1}, \"algorithmic_features\": {\"algorithmic_features_selector\": \"do_not_set\", \"__current_case__\": 1}}, \"output_options\": {\"flavor\": \"vcf\", \"__current_case__\": 0}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 1, \"batchmode\": {\"processmode\": \"individual\", \"__current_case__\": 0, \"input_bams\": {\"__class__\": \"ConnectedValue\"}}, \"ref_file\": {\"__class__\": \"ConnectedValue\"}}, \"target_limit_type\": {\"target_limit_type_selector\": \"do_not_limit\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.3.10+galaxy1", + "type": "tool", + "uuid": "2d59df66-a044-46f7-baa7-7da73293a238", + "when": null, + "workflow_outputs": [ + { + "label": "FreeBayes raw genomic variant calls", + "output_name": "output_vcf", + "uuid": "2ee04238-e4fd-47a6-aa9c-50a999e7d67a" + } + ] + }, + "46": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bbtools_bbduk/bbtools_bbduk/39.08+galaxy4", + "errors": null, + "id": 46, + "input_connections": { + "input_type_cond|read1": { + "id": 37, + "output_name": "fq_single" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool BBTools: BBduk", + "name": "input_type_cond" + } + ], + "label": null, + "name": "BBTools: BBduk", + "outputs": [ + { + "name": "outputu", + "type": "fastqsanger" + } + ], + "position": { + "left": 3796.5623204474264, + "top": 2196.5097635888333 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bbtools_bbduk/bbtools_bbduk/39.08+galaxy4", + "tool_shed_repository": { + "changeset_revision": "428de92eac6b", + "name": "bbtools_bbduk", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"advanced_options\": {\"k\": \"27\", \"rcomp\": false, \"maskmiddle\": false, \"minkmerhits\": \"1\", \"minkmerfraction\": \"0.0\", \"mincovfraction\": \"0.0\", \"hammingdistance\": \"0\", \"qhdist\": \"0\", \"editdistance\": \"0\", \"forbidn\": false, \"trimfailures\": false, \"findbestmatch\": false, \"skipr1\": false, \"skipr2\": false, \"entropy\": \"0.3\", \"entropymask\": \"f\", \"entropywindow\": \"50\", \"entropyk\": \"5\"}, \"input_type_cond\": {\"input_type\": \"single\", \"__current_case__\": 0, \"read1\": {\"__class__\": \"ConnectedValue\"}}, \"log_file\": false, \"output_hists_cond\": {\"output_hists\": \"no\", \"__current_case__\": 0}, \"output_stats_cond\": {\"output_stats\": \"no\", \"__current_case__\": 0}, \"outputs_select\": \"outu\", \"reference_type_cond\": {\"reference_type\": \"no_reference\", \"__current_case__\": 0}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "39.08+galaxy4", + "type": "tool", + "uuid": "b7addfcb-9333-463c-8976-bb4d9c310f31", + "when": null, + "workflow_outputs": [] + }, + "47": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "errors": null, + "id": 47, + "input_connections": { + "style_cond|type_cond|pick_from_0|value": { + "id": 39, + "output_name": "output_json" + }, + "style_cond|type_cond|pick_from_1|value": { + "id": 40, + "output_name": "output_json" + } + }, + "inputs": [], + "label": null, + "name": "Pick parameter value", + "outputs": [ + { + "name": "data_param", + "type": "input" + } + ], + "position": { + "left": 4213.603719853027, + "top": 379.9535052033517 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/pick_value/pick_value/0.2.0", + "tool_shed_repository": { + "changeset_revision": "b19e21af9c52", + "name": "pick_value", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"style_cond\": {\"pick_style\": \"first\", \"__current_case__\": 0, \"type_cond\": {\"param_type\": \"data\", \"__current_case__\": 4, \"pick_from\": [{\"__index__\": 0, \"value\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"value\": {\"__class__\": \"ConnectedValue\"}}]}}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.2.0", + "type": "tool", + "uuid": "bbccad7f-b03c-4a3b-b2a4-5f2859f3b770", + "when": null, + "workflow_outputs": [] + }, + "48": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd_contamination/0.940+galaxy0", + "errors": null, + "id": 48, + "input_connections": { + "hapmap_file": { + "id": 8, + "output_name": "output" + }, + "icnts_file": { + "id": 43, + "output_name": "output_icnts" + }, + "when": { + "id": 17, + "output_name": "output_param_boolean" + } + }, + "inputs": [], + "label": null, + "name": "ANGSD X-Contamination", + "outputs": [ + { + "name": "output_txt", + "type": "tabular" + } + ], + "position": { + "left": 4095.2649258950614, + "top": 1907.7912175223305 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/angsd/angsd_contamination/0.940+galaxy0", + "tool_shed_repository": { + "changeset_revision": "7b0e59047b2f", + "name": "angsd", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"generate_json\": false, \"hapmap_file\": {\"__class__\": \"ConnectedValue\"}, \"icnts_file\": {\"__class__\": \"ConnectedValue\"}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "0.940+galaxy0", + "type": "tool", + "uuid": "f47efc7e-ac0c-48fa-91f2-70fa86a26230", + "when": "$(inputs.when)", + "workflow_outputs": [ + { + "label": "ANGSD report of nuclear contamination estimation", + "output_name": "output_txt", + "uuid": "9346e028-6b32-4ed7-abaf-a2d6b2ea577c" + } + ] + }, + "49": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_stats/bcftools_stats/1.22+galaxy0", + "errors": null, + "id": 49, + "input_connections": { + "input_file": { + "id": 45, + "output_name": "output_vcf" + }, + "sec_default|reference_source|fasta_ref": { + "id": 6, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool bcftools stats", + "name": "inputB_file" + }, + { + "description": "runtime parameter for tool bcftools stats", + "name": "sec_default" + }, + { + "description": "runtime parameter for tool bcftools stats", + "name": "sec_restrict" + } + ], + "label": null, + "name": "bcftools stats", + "outputs": [ + { + "name": "output_file", + "type": "txt" + } + ], + "position": { + "left": 4096.571351088597, + "top": 2747.791161456268 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/bcftools_stats/bcftools_stats/1.22+galaxy0", + "tool_shed_repository": { + "changeset_revision": "fcf941c241cc", + "name": "bcftools_stats", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"inputB_file\": {\"__class__\": \"RuntimeValue\"}, \"input_file\": {\"__class__\": \"ConnectedValue\"}, \"plot_title\": \"\", \"sec_default\": {\"first_allele_only\": false, \"depth\": {\"set_depth\": \"no\", \"__current_case__\": 0}, \"reference_source\": {\"reference_source_selector\": \"history\", \"__current_case__\": 2, \"fasta_ref\": {\"__class__\": \"ConnectedValue\"}}, \"exons_file\": {\"__class__\": \"RuntimeValue\"}, \"split_by_ID\": false, \"user_tstv\": \"\", \"afbins\": {\"afbins_select\": \"default\", \"__current_case__\": 0}, \"af_tag\": \"\", \"verbose\": false}, \"sec_restrict\": {\"samples\": \"\", \"invert_samples\": false, \"samples_file\": {\"__class__\": \"RuntimeValue\"}, \"invert_samples_file\": false, \"apply_filters\": \"\", \"collapse\": null, \"regions\": {\"regions_src\": \"__none__\", \"__current_case__\": 0}, \"targets\": {\"targets_src\": \"__none__\", \"__current_case__\": 0}, \"include\": null, \"exclude\": null}, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.22+galaxy0", + "type": "tool", + "uuid": "5e982d4e-fc9f-4b15-8b85-e8298378d320", + "when": null, + "workflow_outputs": [ + { + "label": "Bcftools variant calling summary statistics report", + "output_name": "output_file", + "uuid": "1d7f735a-c7b8-4db9-804b-9d0920684a5c" + } + ] + }, + "50": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/kraken2/kraken2/2.17.1+galaxy0", + "errors": null, + "id": 50, + "input_connections": { + "kraken2_database": { + "id": 10, + "output_name": "output" + }, + "single_paired|input_sequences": { + "id": 46, + "output_name": "outputu" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Kraken2", + "name": "single_paired" + } + ], + "label": null, + "name": "Kraken2", + "outputs": [ + { + "name": "report_output", + "type": "tabular" + }, + { + "name": "output", + "type": "tabular" + } + ], + "position": { + "left": 4097.553048440093, + "top": 2223.5292724103183 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/kraken2/kraken2/2.17.1+galaxy0", + "tool_shed_repository": { + "changeset_revision": "cbe396d9773e", + "name": "kraken2", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"confidence\": \"0.0\", \"kraken2_database\": {\"__class__\": \"ConnectedValue\"}, \"min_base_quality\": \"0\", \"minimum_hit_groups\": \"2\", \"quick\": false, \"report\": {\"create_report\": \"true\", \"__current_case__\": 0, \"use_mpa_style\": false, \"report_zero_counts\": false, \"report_minimizer_data\": true}, \"single_paired\": {\"single_paired_selector\": \"no\", \"__current_case__\": 1, \"input_sequences\": {\"__class__\": \"ConnectedValue\"}}, \"split_reads\": false, \"use_names\": false, \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "2.17.1+galaxy0", + "type": "tool", + "uuid": "72c51a71-193c-48a7-a2e3-c9186a602e45", + "when": null, + "workflow_outputs": [ + { + "label": "Kraken2 taxonomic classification and microbial screening report", + "output_name": "report_output", + "uuid": "46c3c191-2f90-46fa-bf32-6f3a696a8a66" + } + ] + }, + "51": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.34+galaxy0", + "errors": null, + "id": 51, + "input_connections": { + "results_0|software_cond|output_0|input": { + "id": 25, + "output_name": "data_param" + }, + "results_0|software_cond|output_1|input": { + "id": 26, + "output_name": "data_param" + }, + "results_10|software_cond|input": { + "id": 44, + "output_name": "damage_visualisation" + }, + "results_11|software_cond|input": { + "id": 49, + "output_name": "output_file" + }, + "results_1|software_cond|input": { + "id": 24, + "output_name": "data_param" + }, + "results_2|software_cond|output_0|input": { + "id": 29, + "output_name": "text_file" + }, + "results_3|software_cond|input": { + "id": 32, + "output_name": "output_tsv" + }, + "results_4|software_cond|output_0|type|input": { + "id": 33, + "output_name": "output1" + }, + "results_5|software_cond|output_0|type|input": { + "id": 35, + "output_name": "output1" + }, + "results_6|software_cond|output_0|input": { + "id": 36, + "output_name": "metrics_file" + }, + "results_7|software_cond|input": { + "id": 47, + "output_name": "data_param" + }, + "results_8|software_cond|input": { + "id": 41, + "output_name": "output_html" + }, + "results_9|software_cond|input": { + "id": 50, + "output_name": "report_output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool MultiQC", + "name": "image_content_input" + } + ], + "label": null, + "name": "MultiQC", + "outputs": [ + { + "name": "html_report", + "type": "html" + }, + { + "name": "stats", + "type": "tabular" + } + ], + "position": { + "left": 4722.126409775854, + "top": 914.3393867847972 + }, + "post_job_actions": {}, + "tool_id": "toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.34+galaxy0", + "tool_shed_repository": { + "changeset_revision": "371299578b8e", + "name": "multiqc", + "owner": "iuc", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"comment\": \"\", \"export\": false, \"flat\": false, \"image_content_input\": {\"__class__\": \"RuntimeValue\"}, \"png_plots\": false, \"results\": [{\"__index__\": 0, \"software_cond\": {\"software\": \"fastqc\", \"__current_case__\": 9, \"output\": [{\"__index__\": 0, \"type\": \"data\", \"input\": {\"__class__\": \"ConnectedValue\"}}, {\"__index__\": 1, \"type\": \"data\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 1, \"software_cond\": {\"software\": \"adapterremoval\", \"__current_case__\": 0, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 2, \"software_cond\": {\"software\": \"fastqc\", \"__current_case__\": 9, \"output\": [{\"__index__\": 0, \"type\": \"data\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 3, \"software_cond\": {\"software\": \"preseq\", \"__current_case__\": 44, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 4, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 25, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"flagstat\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}, {\"__index__\": 5, \"software_cond\": {\"software\": \"samtools\", \"__current_case__\": 25, \"output\": [{\"__index__\": 0, \"type\": {\"type\": \"flagstat\", \"__current_case__\": 1, \"input\": {\"__class__\": \"ConnectedValue\"}}}]}}, {\"__index__\": 6, \"software_cond\": {\"software\": \"picard\", \"__current_case__\": 18, \"output\": [{\"__index__\": 0, \"type\": \"markdups\", \"input\": {\"__class__\": \"ConnectedValue\"}}]}}, {\"__index__\": 7, \"software_cond\": {\"software\": \"sexdeterrmine\", \"__current_case__\": 43, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 8, \"software_cond\": {\"software\": \"qualimap\", \"__current_case__\": 21, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 9, \"software_cond\": {\"software\": \"kraken\", \"__current_case__\": 34, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 10, \"software_cond\": {\"software\": \"mapdamage\", \"__current_case__\": 45, \"input\": {\"__class__\": \"ConnectedValue\"}}}, {\"__index__\": 11, \"software_cond\": {\"software\": \"bcftools\", \"__current_case__\": 2, \"input\": {\"__class__\": \"ConnectedValue\"}}}], \"title\": \"\", \"__page__\": 0, \"__rerun_remap_job_id__\": null}", + "tool_uuid": null, + "tool_version": "1.34+galaxy0", + "type": "tool", + "uuid": "c2f12730-493a-447e-83c1-bb255f5d93ef", + "when": null, + "workflow_outputs": [ + { + "label": "MultiQC aggregated workflow summary report", + "output_name": "html_report", + "uuid": "30712e44-8e0c-441a-9990-cf51195542a4" + } + ] + } + }, + "tags": [], + "uuid": "ab793987-07cf-42f4-b819-96720aefed33", + "version": 4 +} \ No newline at end of file